ankk1

Ensembl ID:
ENSDARG00000056921
ZFIN ID:
ZDB-GENE-071015-4
Description:
ankyrin repeat and kinase domain containing 1 [Source:RefSeq peptide;Acc:NP_001124137]
Human Orthologue:
ANKK1
Human Description:
ankyrin repeat and kinase domain containing 1 [Source:HGNC Symbol;Acc:21027]
Mouse Orthologue:
Ankk1
Mouse Description:
ankyrin repeat and kinase domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:3045301]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8927 Nonsense Mutation detected in F1 DNA During 2014
sa5880 Essential Splice Site Mutation detected in F1 DNA During 2014
sa22635 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8927
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079504 Nonsense 24 733 1 8
Genomic Location:
Chromosome 15 (position 20975760)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTGAAGGACTCTTTTAAAGATGGCAGCCTGGAGGGGTTTAGTTATTTT[A/T]AAAAAGATGAGTTTGAAAGTGACTGGGAGAAACTGGTTGAGCGCAAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5880
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079504 Essential Splice Site 308 733 7 8
Genomic Location:
Chromosome 15 (position 20984976)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTAAAATCCATGACAATAAAATGAATTCAATTGTGCTTTCCCTCCATT[A/C]GCCCAAGAAAACGGCTGACTCCTCAGGCAAGTATTTTTCAATGCATTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22635
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079504 Nonsense 605 733 8 8
Genomic Location:
Chromosome 15 (position 20985982)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGAAAGGCCATCCGGAGATTATCCTCACCTTGGAGGAACACCAAGGCT[C/A]AGTCAACATTCAAGGGAAAAACGGCTGGACGCCTTTGCATCTTGCCTGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ezfofea6