si:ch211-237l4.5

Ensembl ID:
ENSDARG00000056913
ZFIN ID:
ZDB-GENE-041014-370
Description:
procollagen C-endopeptidase enhancer [Source:RefSeq peptide;Acc:NP_001025352]
Human Orthologue:
PCOLCE
Human Description:
procollagen C-endopeptidase enhancer [Source:HGNC Symbol;Acc:8738]
Mouse Orthologue:
Pcolce
Mouse Description:
procollagen C-endopeptidase enhancer protein Gene [Source:MGI Symbol;Acc:MGI:105099]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9403 Essential Splice Site Mutation detected in F1 DNA During 2017
sa21725 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9403
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079469 Essential Splice Site 74 448 2 10
ENSDART00000122543 Essential Splice Site 74 487 2 9
Genomic Location (Zv9):
Chromosome 10 (position 22997117)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 22827455
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTYCCATCGTTTTACAAACCCAACAGCAAATGTACYTGGTACATCACGG[T/C]GAGTTYACTCTGATTTCACACTCAAGATTCACCAGATTACTTGAGATWGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21725
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079469 Essential Splice Site 349 448 8 10
ENSDART00000122543 Essential Splice Site 388 487 7 9
Genomic Location (Zv9):
Chromosome 10 (position 22991796)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 22822134
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTAAAAGAGATGGAACTATCAAGACAAGCTTCTGTGCAAGTGAATTTGG[T/C]AAGCAACCATTTGGTACTATTAGAAGCATTAAGAAATATGTATATCACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link