LOC559590

Ensembl ID:
ENSDARG00000056910
Human Orthologue:
NFASC
Human Description:
neurofascin [Source:HGNC Symbol;Acc:29866]
Mouse Orthologue:
Nfasc
Mouse Description:
neurofascin Gene [Source:MGI Symbol;Acc:MGI:104753]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11230 Essential Splice Site Available for shipment Available now
sa43940 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa11230
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079487 Essential Splice Site 62 1166 3 26
Genomic Location:
Chromosome 23 (position 18072089)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAATAATTWAAAAAAATGCTGAYGATCATATGATCACACCCTGTACGT[A/C]GCTTCACATGGACGCGTAATGGAGTTTACCTGAACGTGGCAYGGGATCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43940
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079487 Nonsense 272 1166 7 26
Genomic Location:
Chromosome 23 (position 18076505)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTTTTTCTTTGTAGTCCAACTCCCTCCATCAAATGGACTAAAGATTA[T/A]GAAGAGATGACTATGACAGGGAAGAAGCTGGAGAATTTTAATAAGACGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link