mrpl13

Ensembl ID:
ENSDARG00000056903
ZFIN ID:
ZDB-GENE-050522-167
Description:
39S ribosomal protein L13, mitochondrial [Source:RefSeq peptide;Acc:NP_001018370]
Human Orthologue:
MRPL13
Human Description:
mitochondrial ribosomal protein L13 [Source:HGNC Symbol;Acc:14278]
Mouse Orthologue:
Mrpl13
Mouse Description:
mitochondrial ribosomal protein L13 Gene [Source:MGI Symbol;Acc:MGI:2137218]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12113 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12113
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079480 Essential Splice Site 10 179 2 7
Genomic Location:
Chromosome 16 (position 17389573)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGCAATGTCAGCTTGTATTTCATTAATTTTATTGTCTTTTTCCTGCAA[G/A]CAATGGGCAACCTTTGCCAGATCGTGGTTTCTKATTGATGCTCGGATGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hkhfwc8v