TTC12

Ensembl ID:
ENSDARG00000056896
Description:
tetratricopeptide repeat domain 12 [Source:HGNC Symbol;Acc:23700]
Human Orthologue:
TTC12
Human Description:
tetratricopeptide repeat domain 12 [Source:HGNC Symbol;Acc:23700]
Mouse Orthologue:
Ttc12
Mouse Description:
tetratricopeptide repeat domain 12 Gene [Source:MGI Symbol;Acc:MGI:2444588]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12186 Essential Splice Site Available for shipment Available now
sa17289 Nonsense Available for shipment Available now
sa24981 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12186
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079413 Essential Splice Site 110 710 5 23
Genomic Location:
Chromosome 15 (position 20910007)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GMATTGTCAGKTTGCAACATCTAGATTTRCYTYGTCCTTATTTGATCCAC[A/T]GTGCTAAGGGAGCAAGGGAATGAGGCTTTCACTCAAGGTGACTATGAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17289
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079413 Nonsense 142 710 5 23
Genomic Location:
Chromosome 15 (position 20910104)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACGGCTGTMAGGTTTTACACTGAGGGCTTGGAGCAGYTGCGTGATATG[C/T]AGGCTCTCTATACAAACAGAGCTCAGGTACTTCTTCAAGTTTTTGTACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24981
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079413 Essential Splice Site 387 710 12 23
Genomic Location:
Chromosome 15 (position 20925911)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACTCAGCACGGTAGAGAGCTGATCATCCACAACCTGGATTCACAACAG[T/A]ATGTGTTTTTGAGGTCATATCGATGATGATGATGATGTGCCATAAATTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/a4szw17o