mpp6a

Ensembl ID:
ENSDARG00000056892
ZFIN ID:
ZDB-GENE-050506-35
Description:
Im:6899520 protein [Source:UniProtKB/TrEMBL;Acc:Q6PBR1]
Human Orthologue:
MPP6
Human Description:
membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6) [Source:HGNC Symbol;Acc:18167]
Mouse Orthologue:
Mpp6
Mouse Description:
membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6) Gene [Source:MGI Symbol;Acc:MGI:192

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22818 Nonsense Mutation detected in F1 DNA During 2014
sa22817 Essential Splice Site Mutation detected in F1 DNA During 2014
sa22816 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22818
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124772 Nonsense 244 539 5 11
ENSDART00000131159 Nonsense 255 318 8 10
ENSDART00000146914 None None 170 None 3
Genomic Location:
Chromosome 16 (position 23541055)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAACACCGATAACCTGATCCCATGTAGGGAGGCGGGTTTGGCTTTCTCC[A/T]AAGGAGACATTTTGCATATAGTGAACAAGGAGGACCCCAACTGGTGGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22817
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124772 Essential Splice Site 317 539 7 11
ENSDART00000131159 None None 318 None 10
ENSDART00000146914 None None 170 None 3
Genomic Location:
Chromosome 16 (position 23540334)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAAAAAAAAAGAAAAAGAAAATGATGTACTTAACGGCGAAGAATGCAGG[T/C]TAGTACTGCTTTTAAACACTTACACATTTGTTATTTCAAATGTTTGCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22816
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124772 Nonsense 351 539 8 11
ENSDART00000131159 None None 318 None 10
ENSDART00000146914 None None 170 None 3
Genomic Location:
Chromosome 16 (position 23536222)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTCCAGAGAAAAACTCTTGTTCTGATTGGTGCTCAGGGTGTGGGCCGT[C/T]GAAGCCTCAAGAACCGACTGATTGTGTTAAACCCATTGAGATATGGAACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hajjrxzg