si:ch211-194d6.5

Ensembl ID:
ENSDARG00000056886
ZFIN ID:
ZDB-GENE-041210-222
Description:
TBCC domain-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:A4QP31]
Human Orthologue:
TBCCD1
Human Description:
TBCC domain containing 1 [Source:HGNC Symbol;Acc:25546]
Mouse Orthologue:
Tbccd1
Mouse Description:
TBCC domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1917823]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21496 Essential Splice Site Available for shipment Available now
sa34661 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21496
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064156 Essential Splice Site 350 582 6 7
Genomic Location (Zv9):
Chromosome 9 (position 28778597)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 27934293
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAAAGTGCTGTGTCAACGTCCATTTTAACCAAGTCTTTGTGTCCTGCA[G/T]GTCTGTGACCCTGGACAAGTGCAGAAACAGTACACTAGTTCTGGGGCCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34661
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064156 Nonsense 460 582 6 7
Genomic Location (Zv9):
Chromosome 9 (position 28778266)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 27933962
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCAGCCTCTGCTGTTTGGAGTCGAGGGTTCAGCTCCAGATACAGGCTG[C/A]TACCGAATCCAGCCCCCTTCTGAGTTTTATCCACTAGTGATTCCCTTCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link