per1a

Ensembl ID:
ENSDARG00000056885
ZFIN ID:
ZDB-GENE-011220-1
Description:
period 1 [Source:RefSeq peptide;Acc:NP_001025354]
Human Orthologue:
PER1
Human Description:
period homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:8845]
Mouse Orthologue:
Per1
Mouse Description:
period homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1098283]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16532 Essential Splice Site Available for shipment Available now
sa14433 Nonsense Available for shipment Available now
sa41652 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa16532
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079459 Essential Splice Site 385 1229 7 18
ENSDART00000100468 Essential Splice Site 385 1352 7 19
ENSDART00000121968 Essential Splice Site 420 1387 7 19
Genomic Location (Zv9):
Chromosome 10 (position 23019900)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 22850238
KASP Assay ID:
2260-3205.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTACCTGCATCCAGAAGACAGACTGCYCATGGTGGCCATTCAYAAGAAAA[G/A]TGAGTCRTTCATTCTGAATTCAGTGGTGAATGTTTGYAAAGTAAGACTCK
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14433
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079459 Nonsense 774 1229 15 18
ENSDART00000100468 Nonsense 813 1352 15 19
ENSDART00000121968 Nonsense 848 1387 15 19
Genomic Location (Zv9):
Chromosome 10 (position 23015154)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 22845492
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YCCTGACTCCCTTTTTATTTGATTTTAGGAGTGAACAGCTCCCAGAACTA[T/A]CCTTCTGTAGGYAACACCAGCAGTCGTCGGCATGGCAGRGGTGGGAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41652
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079459   None 1229 None 18
ENSDART00000100468 Essential Splice Site 1119 1352 15 19
ENSDART00000121968 Essential Splice Site 1154 1387 15 19
Genomic Location (Zv9):
Chromosome 10 (position 23014235)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 22844573
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAATTCCAGCAATCGCAGCAACACTCAAGATGCCAAACTAAATGACCAT[G/A]TAAGTATTAAGGACTATTTTAAACTCTTTGGTTTTTCCAGAACCTTGCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link