cep63

Ensembl ID:
ENSDARG00000056862
ZFIN ID:
ZDB-GENE-040426-1154
Description:
Centrosomal protein of 63 kDa [Source:UniProtKB/Swiss-Prot;Acc:Q6PGZ0]
Human Orthologue:
CEP63
Human Description:
centrosomal protein 63kDa [Source:HGNC Symbol;Acc:25815]
Mouse Orthologue:
Cep63
Mouse Description:
centrosomal protein 63 Gene [Source:MGI Symbol;Acc:MGI:2158560]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20711 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20711
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079419 Nonsense 210 689 6 15
ENSDART00000128935 Nonsense 237 716 6 15
ENSDART00000136833 None None 102 None 2
ENSDART00000145533 None None 92 None 2
Genomic Location:
Chromosome 6 (position 27620802)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGAGACTTCGGCTGCTCCAGGATGAGCTGGGAGACTCCATCAAGGAA[C/T]AGCAGGTCAGCTGCCACGCTGCAGCTCACAGACGGGGACAGGTAGATCCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Genome-wide association analysis identifies 20 loci that influence adult height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ibkws7z1