tax1bp1b

Ensembl ID:
ENSDARG00000056856
ZFIN ID:
ZDB-GENE-030131-2872
Description:
Tax1-binding protein 1 homolog B [Source:UniProtKB/Swiss-Prot;Acc:Q6P132]
Human Orthologue:
TAX1BP1
Human Description:
Tax1 (human T-cell leukemia virus type I) binding protein 1 [Source:HGNC Symbol;Acc:11575]
Mouse Orthologue:
Tax1bp1
Mouse Description:
Tax1 (human T-cell leukemia virus type I) binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1289308]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36099 Nonsense Mutation detected in F1 DNA During 2016
sa36098 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36099
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040727 Nonsense 75 810 3 18
ENSDART00000129906 Nonsense 88 823 3 18
Genomic Location (Zv9):
Chromosome 16 (position 22921281)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 21031032
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTGTGGTCACCTCTTCCTGACAACTACACCGAGGGAACCGCAATCAAC[A/T]GATCTGTGGTCTTCCAAGGTAAAACACTGTCAAAAATGGGGTTTTATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36098
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040727 Nonsense 541 810 13 18
ENSDART00000129906 Nonsense 554 823 13 18
Genomic Location (Zv9):
Chromosome 16 (position 22906812)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 21016563
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTTCTGCATCTGCTTGATATCCTAACGTGCTTACTTTGCAGGAGGAA[C/T]GAGAGCGTTGCAGCATGATAACTGATGAGCTCACGAAGATGGAGGTGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link