tax1bp1b

Ensembl ID:
ENSDARG00000056856
ZFIN ID:
ZDB-GENE-030131-2872
Description:
Tax1-binding protein 1 homolog B [Source:UniProtKB/Swiss-Prot;Acc:Q6P132]
Human Orthologue:
TAX1BP1
Human Description:
Tax1 (human T-cell leukemia virus type I) binding protein 1 [Source:HGNC Symbol;Acc:11575]
Mouse Orthologue:
Tax1bp1
Mouse Description:
Tax1 (human T-cell leukemia virus type I) binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1289308]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36099 Nonsense Mutation detected in F1 DNA During 2016
sa19138 Nonsense Mutation detected in F1 DNA During 2016
sa36098 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa36099
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040727 Nonsense 75 810 3 18
ENSDART00000129906 Nonsense 88 823 3 18
Genomic Location:
Chromosome 16 (position 22921281)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTGTGGTCACCTCTTCCTGACAACTACACCGAGGGAACCGCAATCAAC[A/T]GATCTGTGGTCTTCCAAGGTAAAACACTGTCAAAAATGGGGTTTTATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19138
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040727 Nonsense 458 810 10 18
ENSDART00000129906 Nonsense 471 823 10 18
Genomic Location:
Chromosome 16 (position 22907352)
KASP Assay ID:
2260-9552.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTTAAGGCTCAGGCTGCAGATGGCTGCTGAACACTATAAAGACAAGTA[T/A]AAGGAATGCCAGAAGCTCCAGAAACAAGTGGTCAAGTTCAATGAACAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36098
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040727 Nonsense 541 810 13 18
ENSDART00000129906 Nonsense 554 823 13 18
Genomic Location:
Chromosome 16 (position 22906812)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTTCTGCATCTGCTTGATATCCTAACGTGCTTACTTTGCAGGAGGAA[C/T]GAGAGCGTTGCAGCATGATAACTGATGAGCTCACGAAGATGGAGGTGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link