tax1bp1b

Ensembl ID:
ENSDARG00000056856
ZFIN ID:
ZDB-GENE-030131-2872
Description:
Tax1-binding protein 1 homolog B [Source:UniProtKB/Swiss-Prot;Acc:Q6P132]
Human Orthologue:
TAX1BP1
Human Description:
Tax1 (human T-cell leukemia virus type I) binding protein 1 [Source:HGNC Symbol;Acc:11575]
Mouse Orthologue:
Tax1bp1
Mouse Description:
Tax1 (human T-cell leukemia virus type I) binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1289308]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19138 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19138
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040727 Nonsense 458 810 10 18
ENSDART00000129906 Nonsense 471 823 10 18
Genomic Location:
Chromosome 16 (position 22907352)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTTAAGGCTCAGGCTGCAGATGGCTGCTGAACACTATAAAGACAAGTA[T/A]AAGGAATGCCAGAAGCTCCAGAAACAAGTGGTCAAGTTCAATGAACAGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/d43zkq3k