si:ch211-107m4.1

Ensembl ID:
ENSDARG00000056830
ZFIN ID:
ZDB-GENE-081107-3
Human Orthologue:
HNRNPUL2
Human Description:
heterogeneous nuclear ribonucleoprotein U-like 2 [Source:HGNC Symbol;Acc:25451]
Mouse Orthologue:
Hnrnpul2
Mouse Description:
heterogeneous nuclear ribonucleoprotein U-like 2 Gene [Source:MGI Symbol;Acc:MGI:1915943]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35688 Nonsense Mutation detected in F1 DNA During 2017
sa11936 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35688
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079385 Nonsense 18 716 1 14
ENSDART00000137167 Nonsense 18 662 1 11
Genomic Location (Zv9):
Chromosome 14 (position 23498374)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 22198164
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGCGGGAGGAAGTGAAAAAGCTGAAAGTGACGGAGTTGCGGGCCATGT[T/A]GAAAGAGCGAGGACTTGAAGCGAAGGGCCTGAAGGCCGAGCTTGTGGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11936
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079385 Nonsense 111 716 1 14
ENSDART00000137167 Nonsense 111 662 1 11
Genomic Location (Zv9):
Chromosome 14 (position 23498094)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 22197884
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATRAAAGATTTTGCTGATCAAARTACACAGACTGARCCACAGCAGCTCTG[T/A]TCATGTCGCCTCRTCGATGYTAGTGCCATCGCAGAGCCGCTGACCACGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link