hoxa9b

Ensembl ID:
ENSDARG00000056819
ZFIN ID:
ZDB-GENE-000823-2
Description:
Homeobox protein Hox-A9b [Source:UniProtKB/Swiss-Prot;Acc:Q9YGT5]
Human Orthologue:
HOXA9
Human Description:
homeobox A9 [Source:HGNC Symbol;Acc:5109]
Mouse Orthologue:
Hoxa9
Mouse Description:
homeobox A9 Gene [Source:MGI Symbol;Acc:MGI:96180]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6422 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6422
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079383 Nonsense 51 253 1 2
Genomic Location (Zv9):
Chromosome 16 (position 23000023)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 21109774
KASP Assay ID:
554-4839.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCAGTCTCGTGAACTGACGCTACTTGAATATRGCGAACAAGAGCCCTA[T/A]ACTTTCCAGGCCAAATCATCCATTTTTGGTGCGTCGTGGAGTCCCGTGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link