LOC100334568

Ensembl ID:
ENSDARG00000056806
Human Orthologue:
PDE5A
Human Description:
phosphodiesterase 5A, cGMP-specific [Source:HGNC Symbol;Acc:8784]
Mouse Orthologue:
Pde5a
Mouse Description:
phosphodiesterase 5A, cGMP-specific Gene [Source:MGI Symbol;Acc:MGI:2651499]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8885 Essential Splice Site Mutation detected in F1 DNA During 2015
sa19451 Nonsense Mutation detected in F1 DNA During 2015
sa30581 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa8885
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079359 Essential Splice Site 315 922 2 21
Genomic Location:
Chromosome 1 (position 13158074)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATGTAGTCAGGACTGGGAGACCTCTTACCGTCAAGGATGCCCATGAGG[T/C]ACAGTAYGAGGGATGTTCTTGTCTAAACCTTCTCYAAGTCATTTCAGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19451
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079359 Nonsense 413 922 6 21
Genomic Location:
Chromosome 1 (position 13151868)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGATTGACAGGTGCTGTTGGAGTTGGCTCAGCTGGTGTCACATGACTA[T/A]CCATCTGTGGACGCCATGCTCGGTGAACTGGCTGCCGTTATTCTACCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30581
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079359 Nonsense 839 922 19 21
Genomic Location:
Chromosome 1 (position 13142413)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTTATCTCAACCTCAACAGATCGCTGAGCTTGTAGCAACTGAATTTTA[T/A]GCGCAAGGAGACAGAGAGAAGCGTGAACTCAACATTCAACCCATTGTAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/huhgjc1d