LOC100334568

Ensembl ID:
ENSDARG00000056806
Human Orthologue:
PDE5A
Human Description:
phosphodiesterase 5A, cGMP-specific [Source:HGNC Symbol;Acc:8784]
Mouse Orthologue:
Pde5a
Mouse Description:
phosphodiesterase 5A, cGMP-specific Gene [Source:MGI Symbol;Acc:MGI:2651499]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8885 Essential Splice Site Mutation detected in F1 DNA During 2014
sa19451 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8885
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079359 Essential Splice Site 315 922 2 21
Genomic Location:
Chromosome 1 (position 13158074)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATGTAGTCAGGACTGGGAGACCTCTTACCGTCAAGGATGCCCATGAGG[T/C]ACAGTAYGAGGGATGTTCTTGTCTAAACCTTCTCYAAGTCATTTCAGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19451
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079359 Nonsense 413 922 6 21
Genomic Location:
Chromosome 1 (position 13151868)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGATTGACAGGTGCTGTTGGAGTTGGCTCAGCTGGTGTCACATGACTA[T/A]CCATCTGTGGACGCCATGCTCGGTGAACTGGCTGCCGTTATTCTACCAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/huhgjc1d