ENSDARG00000056805

Ensembl ID:
ENSDARG00000056805
Human Orthologue:
PLCH2
Human Description:
phospholipase C, eta 2 [Source:HGNC Symbol;Acc:29037]
Mouse Orthologue:
Plch2
Mouse Description:
phospholipase C, eta 2 Gene [Source:MGI Symbol;Acc:MGI:2443078]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14770 Nonsense Available for shipment Available now
sa16949 Nonsense Available for shipment Available now
sa8455 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14770
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079328 Nonsense 309 806 6 20
ENSDART00000079328 Nonsense 309 806 6 20
Genomic Location:
Chromosome 11 (position 26698312)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTGACTGCTGGGATGGYCCTGATGGTGAACCTATTGTGCATCATGGAWA[C/A]ACGCTTACCTCAAAAATCCTCTTTAAGGATGTTGTTGAGACAATCAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16949
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079328 Nonsense 309 806 6 20
ENSDART00000079328 Nonsense 309 806 6 20
Genomic Location:
Chromosome 11 (position 26698312)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTGACTGCTGGGATGGYCCTGATGGTGAACCTATTGTGCATCATGGAWA[C/A]ACGCTTACCTCAAAAAYCCTCTTTAAGGATGTTGTTGAGACAATCAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8455
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079328 Nonsense 500 806 12 20
Genomic Location:
Chromosome 11 (position 26695138)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAATCAAAGAAACGCTCACGGAGGAAGTTCATGGGCAGCTTCAGGCGC[A/T]AGGTCTGCAAATGGCTTTAGACCAGTGMAATTGGGTAAAAGAAATGAAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)
  • Ulcerative colitis: Meta-analysis identifies 29 additional ulcerative colitis risk loci, increasing the number of confirmed associations to 47. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jaci7iie