med12

Ensembl ID:
ENSDARG00000056800
ZFIN ID:
ZDB-GENE-060125-1
Description:
Mediator of RNA polymerase II transcription subunit 12 [Source:UniProtKB/Swiss-Prot;Acc:Q2QCI8]
Human Orthologue:
MED12
Human Description:
mediator complex subunit 12 [Source:HGNC Symbol;Acc:11957]
Mouse Orthologue:
Med12
Mouse Description:
mediator of RNA polymerase II transcription, subunit 12 homolog (yeast) Gene [Source:MGI Symbol;Acc:

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18291 Nonsense Available for shipment Available now
sa6342 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18291
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079327 Nonsense 17 302 1 5
Genomic Location:
Chromosome 14 (position 24569812)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATGCAGTAYGCTCCAGGCATGACCCCTGATCTCCCACTGAGCATGGGA[C/T]AAACAAACATGTCATATCGAATGGGCTACCAAGCTCCAATGAACATGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6342
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079327 Essential Splice Site 106 302 2 5
Genomic Location:
Chromosome 14 (position 24572000)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACCCATGCCCAACATGGCTCAGGGGCAGATGCTCCGTCATCAGCTACAG[G/A]TCAGACTGGTGAGTCTGATTTTACTGATCAAGACCCCAGACCAAAAACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2v0282pj