ppp2r2c

Ensembl ID:
ENSDARG00000056797
ZFIN ID:
ZDB-GENE-051120-168
Description:
serine/threonine-protein phosphatase 2A 55 kDa regulatory subunit B gamma isoform [Source:RefSeq pe
Human Orthologue:
PPP2R2C
Human Description:
protein phosphatase 2, regulatory subunit B, gamma [Source:HGNC Symbol;Acc:9306]
Mouse Orthologue:
Ppp2r2c
Mouse Description:
protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), gamma isoform Gene [Source:MGI Sy

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1990 Essential Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa1990
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017679 Essential Splice Site 352 452 10 11
ENSDART00000075749 Essential Splice Site 352 452 8 9
ENSDART00000141592   None 149 None 4
Genomic Location (Zv9):
Chromosome 1 (position 13190409)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 13619151
KASP Assay ID:
554-2935.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGACTGCATCTTCGACAAGTTTGAGTGTGTCTGGAACAGCACTGACAGG[T/C]AACCATTTTAATTGATCATGTTTATGCAGTATAGGCATTMTTCCTGTATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link