aire

Ensembl ID:
ENSDARG00000056784
ZFIN ID:
ZDB-GENE-071008-4
Description:
autoimmune regulator [Source:RefSeq peptide;Acc:NP_001103484]
Human Orthologue:
AIRE
Human Description:
autoimmune regulator [Source:HGNC Symbol;Acc:360]
Mouse Orthologue:
Aire
Mouse Description:
autoimmune regulator (autoimmune polyendocrinopathy candidiasis ectodermal dystrophy) Gene [Source:M

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17261 Essential Splice Site Available for shipment Available now
sa1404 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17261
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079317 Essential Splice Site 289 513 7 14
ENSDART00000133250 Essential Splice Site 287 511 7 14
ENSDART00000147935 None None 93 None 3
Genomic Location:
Chromosome 2 (position 22277387)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTATGTTGTTGCAGTGTTAACCTGCTACCCTCAAAAAATKACATTTGCT[G/T]TTAGTTCATTACATTGACTATTGACTATTTATTTAAAATCAGCTAAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1404
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079317 None None 513 None 14
ENSDART00000133250 None None 511 None 14
ENSDART00000147935 Nonsense 55 93 3 3
Genomic Location:
Chromosome 2 (position 22303695)
KASP Assay ID:
554-1325.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACAAAGGGCTTGTCTTAATGKAGTTTTCTTCTTTTTATCTAGATAAAGT[G/A]GCCTGGAGCAGAATGGGCCCGTGAACAACCCAGTCCATTGAAGGCCGTCT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Rheumatoid arthritis: The human AIRE gene at chromosome 21q22 is a genetic determinant for the predisposition to rheumatoid arthritis in Japanese population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/n3bgvxok