raraa

Ensembl ID:
ENSDARG00000056783
ZFIN ID:
ZDB-GENE-980526-284
Description:
Retinoic acid receptor alpha-A [Source:UniProtKB/Swiss-Prot;Acc:Q90271]
Human Orthologue:
RARA
Human Description:
retinoic acid receptor, alpha [Source:HGNC Symbol;Acc:9864]
Mouse Orthologue:
Rara
Mouse Description:
retinoic acid receptor, alpha Gene [Source:MGI Symbol;Acc:MGI:97856]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31860 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31860
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079336 Nonsense 127 444 3 8
Genomic Location (Zv9):
Chromosome 12 (position 12235891)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 11091544
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCACCGAGAGAAGAACTGCATCATCAACAAAGTCACCCGCAACCGCTG[T/A]CAATACTGCCGGCTGCAGAAGTGCCTGGAAGTGGGGATGTCCAAAGAATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link