ENSDARG00000056781

Ensembl ID:
ENSDARG00000056781
Mouse Orthologue:
Zan
Mouse Description:
zonadhesin Gene [Source:MGI Symbol;Acc:MGI:106656]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1342 Nonsense Confirmed mutation in F2 line During 2014
sa25362 Essential Splice Site Mutation detected in F1 DNA During 2014
sa3643 Nonsense Mutation detected in F1 DNA During 2014
sa783 Nonsense Available for shipment Available now
sa11398 Essential Splice Site Available for shipment Available now
sa8476 Nonsense Mutation detected in F1 DNA During 2014
sa20943 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa1342
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079322 Nonsense 15 2214 1 42
Genomic Location:
Chromosome 7 (position 27452419)
KASP Assay ID:
554-1256.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCCTCCTGCGACTTCAACGATAATGACGACCCTTTCTGCAACTTTCAA[C/T]AAGACACAGCAGATAATGGTGACTGGACACGACATTATGGACCAACTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25362
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079322 Essential Splice Site 624 2214 11 42
Genomic Location:
Chromosome 7 (position 27467636)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGAGCAATGTGGAGTTCAGGATGGAATAACTGGGTGTTACCCACAAGG[T/C]AAGAACCATATTTAGGCAAGTGAATAGCATGGTCATAGACTTCACATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3643
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079322 Nonsense 701 2214 13 42
Genomic Location:
Chromosome 7 (position 27468170)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAAACTGTAYGTGACTGTTGACGGTATCACTGTGACAATGAWGAAAAAC[A/T]AGAGAACTCTGGTCAGTATTCACAGCAGCAGTCATCATTACACCAAGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa783
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079322 Nonsense 956 2214 18 42
Genomic Location:
Chromosome 7 (position 27470072)
KASP Assay ID:
554-0688.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTGACAACAAATGTGTCCCTGTTAAAGACTGTGGCTGTGTGGACTCTT[C/A]AGGCTCCTACCATCCAGTGAGTTTAACACYAGGGCTGACCCATTGGGCTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa11398
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079322 Essential Splice Site 961 2214 18 42
Genomic Location:
Chromosome 7 (position 27470090)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YCCWGTTAAAGACTGTGGCTGTGTGGACTCTTMAGGCTCCTACCATCCAG[T/C]GAGTTTAACACYAGGGCTGACCCATTGGGCTCTTGCACTGTRGAAGACAY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8476
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079322 Nonsense 1066 2214 20 42
Genomic Location:
Chromosome 7 (position 27472437)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCCATACTTCTCTGTGGAGACACAAAACGAGCACAGAGACAATAATAAA[A/T]AAGTGTCRTATGTAAGATCTGTTATCGTCAAAGTTCACAACACAACAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20943
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079322 Essential Splice Site 1732 2214 31 42
Genomic Location:
Chromosome 7 (position 27480227)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCTCTCTCAAGCTGTGGATGCGTTGACAGCAATGGAGAGTATCACGAC[G/A]TGAGTACAATTTGCACCTAAGTACCAAGCAAAACTCAGCTTTTCTCAATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ih2py7f0