ENSDARG00000056781

Ensembl ID:
ENSDARG00000056781
Mouse Orthologue:
Zan
Mouse Description:
zonadhesin Gene [Source:MGI Symbol;Acc:MGI:106656]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1342 Nonsense Confirmed mutation in F2 line During 2016
sa34069 Essential Splice Site Available for shipment Available now
sa25362 Essential Splice Site Mutation detected in F1 DNA During 2016
sa30631 Nonsense Mutation detected in F1 DNA During 2016
sa783 Nonsense Available for shipment Available now
sa11398 Essential Splice Site Available for shipment Available now
sa8476 Nonsense Mutation detected in F1 DNA During 2016
sa34070 Nonsense Available for shipment Available now
sa20943 Essential Splice Site Available for shipment Available now
sa40893 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa1342
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079322 Nonsense 15 2214 1 42
Genomic Location (Zv9):
Chromosome 7 (position 27452419)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26055358
KASP Assay ID:
554-1256.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCCTCCTGCGACTTCAACGATAATGACGACCCTTTCTGCAACTTTCAA[C/T]AAGACACAGCAGATAATGGTGACTGGACACGACATTATGGACCAACTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34069
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079322 Essential Splice Site 577 2214 10 42
Genomic Location (Zv9):
Chromosome 7 (position 27467393)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26070332
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGAAAGAAAACACATGTGGTTGCACCTTTAATGATCATTATTATAAG[G/A]TAAACAAAACATGTGTTTTAATATCAAACAATGGTTTGTTTTAGTCTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25362
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079322 Essential Splice Site 624 2214 11 42
Genomic Location (Zv9):
Chromosome 7 (position 27467636)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26070575
KASP Assay ID:
554-7552.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGAGCAATGTGGAGTTCAGGATGGAATAACTGGGTGTTACCCACAAGG[T/C]AAGAACCATATTTAGGCAAGTGAATAGCATGGTCATAGACTTCACATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30631
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079322 Nonsense 652 2214 12 42
Genomic Location (Zv9):
Chromosome 7 (position 27467811)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26070750
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACAACACATTTGATGGCAAATTCTACAGCTACATGGGCACTTGCACATA[C/A]ACACTGGCTCGCACCTGCAAAAACAACACCGGTAAGAGATTGCCAAAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa783
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079322 Nonsense 956 2214 18 42
Genomic Location (Zv9):
Chromosome 7 (position 27470072)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26073011
KASP Assay ID:
554-0688.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTGACAACAAATGTGTCCCTGTTAAAGACTGTGGCTGTGTGGACTCTT[C/A]AGGCTCCTACCATCCAGTGAGTTTAACACYAGGGCTGACCCATTGGGCTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa11398
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079322 Essential Splice Site 961 2214 18 42
Genomic Location (Zv9):
Chromosome 7 (position 27470090)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26073029
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YCCWGTTAAAGACTGTGGCTGTGTGGACTCTTMAGGCTCCTACCATCCAG[T/C]GAGTTTAACACYAGGGCTGACCCATTGGGCTCTTGCACTGTRGAAGACAY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8476
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079322 Nonsense 1066 2214 20 42
Genomic Location (Zv9):
Chromosome 7 (position 27472437)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26075376
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCCATACTTCTCTGTGGAGACACAAAACGAGCACAGAGACAATAATAAA[A/T]AAGTGTCRTATGTAAGATCTGTTATCGTCAAAGTTCACAACACAACAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34070
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079322 Nonsense 1416 2214 27 42
Genomic Location (Zv9):
Chromosome 7 (position 27476286)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26079225
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCGCTGGGGATCCTCACTATTACACCTTCGATGGCATCATGCACACCTA[C/A]ATGGGCACCTGTACTTACACACTGGTGGAAGTGTGCAACACCTCTATGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20943
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079322 Essential Splice Site 1732 2214 31 42
Genomic Location (Zv9):
Chromosome 7 (position 27480227)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26083166
KASP Assay ID:
2259-8858.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCTCTCTCAAGCTGTGGATGCGTTGACAGCAATGGAGAGTATCACGAC[G/A]TGAGTACAATTTGCACCTAAGTACCAAGCAAAACTCAGCTTTTCTCAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40893
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079322 Nonsense 2158 2214 41 42
Genomic Location (Zv9):
Chromosome 7 (position 27488340)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26091279
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGCGCACAGAGTTGCGAATGTACAAAGACTGGCGCTGTGTGCCAAGTC[A/T]AGGGCTGCCAGGAGAACGAGATCTGCACTGTGTTCGAAACCAAACTGGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link