cfhl2

Ensembl ID:
ENSDARG00000056778
ZFIN ID:
ZDB-GENE-041114-123
Description:
complement factor H like 2 [Source:RefSeq peptide;Acc:NP_001007419]
Human Orthologues:
CFH, CFHR1, CFHR2, CFHR3, CFHR4, CFHR5
Human Descriptions:
complement factor H [Source:HGNC Symbol;Acc:4883]
complement factor H-related 1 [Source:HGNC Symbol;Acc:4888]
complement factor H-related 2 [Source:HGNC Symbol;Acc:4890]
complement factor H-related 3 [Source:HGNC Symbol;Acc:16980]
complement factor H-related 4 [Source:HGNC Symbol;Acc:16979]
complement factor H-related 5 [Source:HGNC Symbol;Acc:24668]
Mouse Orthologues:
AL837518.1, Cfh, Cfhr1, Cfhr2, Gm4788
Mouse Descriptions:
complement component factor h Gene [Source:MGI Symbol;Acc:MGI:88385]
complement factor H-related 1 Gene [Source:MGI Symbol;Acc:MGI:2138169]
complement factor H-related 2 Gene [Source:MGI Symbol;Acc:MGI:3611575]
predicted gene 4788 Gene [Source:MGI Symbol;Acc:MGI:3646434]
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q8BMW5]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24167 Nonsense Available for shipment Available now
sa37515 Nonsense Mutation detected in F1 DNA During 2016
sa29780 Essential Splice Site Mutation detected in F1 DNA During 2016
sa24168 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24167
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079324 Nonsense 180 606 5 12
Genomic Location (Zv9):
Chromosome 22 (position 24152715)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23720029
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGAGCTGGAGAAAGATTGACAATCACCTGCACTGAAAAAACCTGGTTT[A/T]GATCCAAAGAAACCATCAAAACATTTGCATGTCAAGATGATGGGACGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37515
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079324 Nonsense 291 606 7 12
Genomic Location (Zv9):
Chromosome 22 (position 24153400)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23719344
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGGTTTAGTCAACCCCTAAACAAAACAGTAATCTTTTACGCCTGCAAC[A/T]AGGGTTACAAACCATTCAATGGAGAATGGTGGAGTTCAGTGACGTGTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29780
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079324 Essential Splice Site 430 606 9 12
Genomic Location (Zv9):
Chromosome 22 (position 24154252)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23718492
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACAGTTTTCTGCAGCAATGGAAAATGGGAAGAAACACCAACATGTGAAG[G/A]TGAGATTCTGGTTAATGGTTCATTCAGAACTTTGTTCTAGACAAAGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24168
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079324 Nonsense 519 606 11 12
Genomic Location (Zv9):
Chromosome 22 (position 24164423)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23708321
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAGTAGGAATCCAGATGATAAAATGCCTACTGAGGTATACTATGAATGC[C/T]AGGCTTACTATGTGCTGAGTGAGAGAAAGCAATATTACAGGTGTGAAAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link