cfhl2

Ensembl ID:
ENSDARG00000056778
ZFIN ID:
ZDB-GENE-041114-123
Description:
complement factor H like 2 [Source:RefSeq peptide;Acc:NP_001007419]
Human Orthologues:
CFH, CFHR1, CFHR2, CFHR3, CFHR4, CFHR5
Human Descriptions:
complement factor H [Source:HGNC Symbol;Acc:4883]
complement factor H-related 1 [Source:HGNC Symbol;Acc:4888]
complement factor H-related 2 [Source:HGNC Symbol;Acc:4890]
complement factor H-related 3 [Source:HGNC Symbol;Acc:16980]
complement factor H-related 4 [Source:HGNC Symbol;Acc:16979]
complement factor H-related 5 [Source:HGNC Symbol;Acc:24668]
Mouse Orthologues:
AL837518.1, Cfh, Cfhr1, Cfhr2, Gm4788
Mouse Descriptions:
complement component factor h Gene [Source:MGI Symbol;Acc:MGI:88385]
complement factor H-related 1 Gene [Source:MGI Symbol;Acc:MGI:2138169]
complement factor H-related 2 Gene [Source:MGI Symbol;Acc:MGI:3611575]
predicted gene 4788 Gene [Source:MGI Symbol;Acc:MGI:3646434]
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q8BMW5]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3208 Nonsense Mutation detected in F1 DNA During 2014
sa24167 Nonsense Mutation detected in F1 DNA During 2014
sa24168 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3208
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079324 Nonsense 150 606 5 12
Genomic Location:
Chromosome 22 (position 24152627)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAACTTTGTACTCCTTTTACAGCTGTAACTTGYGAGCTTACTTCAAACTA[T/A]GAGGTGAAAAGGGTCGTCCCAGAGGGAAAAACTATTTTCAGAGCTGGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24167
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079324 Nonsense 180 606 5 12
Genomic Location:
Chromosome 22 (position 24152715)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGAGCTGGAGAAAGATTGACAATCACCTGCACTGAAAAAACCTGGTTT[A/T]GATCCAAAGAAACCATCAAAACATTTGCATGTCAAGATGATGGGACGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24168
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079324 Nonsense 519 606 11 12
Genomic Location:
Chromosome 22 (position 24164423)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAGTAGGAATCCAGATGATAAAATGCCTACTGAGGTATACTATGAATGC[C/T]AGGCTTACTATGTGCTGAGTGAGAGAAAGCAATATTACAGGTGTGAAAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zbsh48iu