cfhl1

Ensembl ID:
ENSDARG00000056771
ZFIN ID:
ZDB-GENE-050208-342
Description:
complement factor H like 1 [Source:RefSeq peptide;Acc:NP_001032792]
Human Orthologues:
CFH, CFHR1, CFHR2, CFHR3, CFHR4, CFHR5
Human Descriptions:
complement factor H [Source:HGNC Symbol;Acc:4883]
complement factor H-related 1 [Source:HGNC Symbol;Acc:4888]
complement factor H-related 2 [Source:HGNC Symbol;Acc:4890]
complement factor H-related 3 [Source:HGNC Symbol;Acc:16980]
complement factor H-related 4 [Source:HGNC Symbol;Acc:16979]
complement factor H-related 5 [Source:HGNC Symbol;Acc:24668]
Mouse Orthologues:
AL837518.1, Cfh, Cfhr1, Cfhr2, Gm4788
Mouse Descriptions:
complement component factor h Gene [Source:MGI Symbol;Acc:MGI:88385]
complement factor H-related 1 Gene [Source:MGI Symbol;Acc:MGI:2138169]
complement factor H-related 2 Gene [Source:MGI Symbol;Acc:MGI:3611575]
predicted gene 4788 Gene [Source:MGI Symbol;Acc:MGI:3646434]
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q8BMW5]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29781 Essential Splice Site Mutation detected in F1 DNA During 2017
sa29782 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa29781
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062522 Essential Splice Site 606 725 12 14
Genomic Location (Zv9):
Chromosome 22 (position 24200917)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23671827
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTGGATCTGTGAAAATGGAAAATGGACTGGAGACTTTGTCTGCACAAG[T/C]AAGTCACTTAAAATGTTTTGGATATAAACTCTATGAATGTACTCACACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29782
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062522 Nonsense 641 725 13 14
Genomic Location (Zv9):
Chromosome 22 (position 24205282)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23667462
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGATGATAAAATGCCTACTGAGGTATACTATGAATGCCAGGCTTACTA[T/A]GTGCTGAGTGAGAGAAAGCAATATTACAGGTGTGAAAACGGGAGATGGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link