itgb3a

Ensembl ID:
ENSDARG00000056767
ZFIN ID:
ZDB-GENE-071207-1
Description:
integrin beta 3a [Source:RefSeq peptide;Acc:NP_001032312]
Human Orthologue:
ITGB3
Human Description:
integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) [Source:HGNC Symbol;Acc:6156]
Mouse Orthologue:
Itgb3
Mouse Description:
integrin beta 3 Gene [Source:MGI Symbol;Acc:MGI:96612]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18375 Essential Splice Site Available for shipment Available now
sa18576 Nonsense Available for shipment Available now
sa40040 Nonsense Mutation detected in F1 DNA During 2016
sa40041 Nonsense Mutation detected in F1 DNA During 2016
sa33142 Essential Splice Site Mutation detected in F1 DNA During 2016
sa40042 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa18375
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025358 Essential Splice Site 377 820 7 15
Genomic Location:
Chromosome 3 (position 19517869)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATCAACCYCATCTTTGCTGTAACCAGCAATGTGGCTCCACTGTATCGTG[T/C]RAGTTTCTGCAMTTTGTCTAWCATCTGTCTATATAACANTTACACMCGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18576
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025358 Nonsense 406 820 8 15
Genomic Location:
Chromosome 3 (position 19518032)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGCTCACTAAAGACTCATCAAATGYTGTGCAACTCATTCTGGAATTGTA[T/A]GCGGTAAGTCACTGYGCCAGGAGTTWTACCTCKGTGTGAGTTCTGAGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40040
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025358 Nonsense 418 820 9 15
Genomic Location:
Chromosome 3 (position 19520444)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCCATTTGTCTTTGCAGAAAATCAGGTCTAAGGTTGAGCTGGAGCTGT[T/A]GAATGTGCCGGATGAGTTATCGCTGTCCGTCACTGCAACATGTCTGGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40041
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025358 Nonsense 450 820 9 15
Genomic Location:
Chromosome 3 (position 19520539)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGATGATGAGGTCATTCCAGGAGTACGGTCCTGTGACGGACTCAAAATT[G/T]GAGATATGGTCAGCAACTGACGCATAAACACTGGAGAAAACCATGCTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33142
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025358 Essential Splice Site 453 820 10 15
Genomic Location:
Chromosome 3 (position 19521800)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTACCATGTGAATTGACCTTTAACTTCTTTTTCTCACTCTCCATGAAA[G/A]GTTTCGTTCAGCATTGAGGCCAAACTTCACGGCTGCCCCAAACAGAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40042
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025358 Essential Splice Site 596 820 10 15
Genomic Location:
Chromosome 3 (position 19522232)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATGTGATGACTTCAGCTGCCCTCGCTCTAAAGGACAACTGTGCTCAGG[T/C]GAAGCTGCAAACACACATAATTTTTTGTGCTTACATATACAACTCCAAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link