itgb3a

Ensembl ID:
ENSDARG00000056767
ZFIN ID:
ZDB-GENE-071207-1
Description:
integrin beta 3a [Source:RefSeq peptide;Acc:NP_001032312]
Human Orthologue:
ITGB3
Human Description:
integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) [Source:HGNC Symbol;Acc:6156]
Mouse Orthologue:
Itgb3
Mouse Description:
integrin beta 3 Gene [Source:MGI Symbol;Acc:MGI:96612]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18375 Essential Splice Site Available for shipment Available now
sa18576 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18375
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025358 Essential Splice Site 377 820 7 15
Genomic Location:
Chromosome 3 (position 19517869)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATCAACCYCATCTTTGCTGTAACCAGCAATGTGGCTCCACTGTATCGTG[T/C]RAGTTTCTGCAMTTTGTCTAWCATCTGTCTATATAACANTTACACMCGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18576
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025358 Nonsense 406 820 8 15
Genomic Location:
Chromosome 3 (position 19518032)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGCTCACTAAAGACTCATCAAATGYTGTGCAACTCATTCTGGAATTGTA[T/A]GCGGTAAGTCACTGYGCCAGGAGTTWTACCTCKGTGTGAGTTCTGAGAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/00dim8df