si:ch211-245p7.3

Ensembl ID:
ENSDARG00000056764
ZFIN ID:
ZDB-GENE-050419-219
Description:
Novel protein similar to vertebrate hydrocephalus inducing (HYDIN) [Source:UniProtKB/TrEMBL;Acc:Q1LW
Human Orthologues:
AC109135.1, AL360154.1, HYDIN
Human Description:
hydrocephalus inducing homolog (mouse) [Source:HGNC Symbol;Acc:19368]
Mouse Orthologue:
Hydin
Mouse Description:
hydrocephalus inducing Gene [Source:MGI Symbol;Acc:MGI:2389007]

Alleles

There are 25 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32204 Nonsense Available for shipment Available now
sa43099 Nonsense Mutation detected in F1 DNA During 2017
sa43100 Essential Splice Site Mutation detected in F1 DNA During 2017
sa17962 Nonsense Available for shipment Available now
sa10786 Essential Splice Site Available for shipment Available now
sa36644 Nonsense Mutation detected in F1 DNA During 2017
sa12926 Nonsense Available for shipment Available now
sa43101 Nonsense Mutation detected in F1 DNA During 2017
sa12486 Essential Splice Site Available for shipment Available now
sa39199 Essential Splice Site Mutation detected in F1 DNA During 2017
sa43102 Nonsense Mutation detected in F1 DNA During 2017
sa36645 Essential Splice Site Available for shipment Available now
sa43103 Nonsense Mutation detected in F1 DNA During 2017
sa29030 Nonsense Mutation detected in F1 DNA During 2017
sa43104 Nonsense Mutation detected in F1 DNA During 2017
sa8483 Essential Splice Site Mutation detected in F1 DNA During 2017
sa17202 Nonsense Available for shipment Available now
sa25063 Nonsense Mutation detected in F1 DNA During 2017
sa43105 Nonsense Mutation detected in F1 DNA During 2017
sa16299 Splice Site, Nonsense Available for shipment Available now
sa12927 Nonsense Available for shipment Available now
sa14679 Nonsense Available for shipment Available now
sa43106 Nonsense Mutation detected in F1 DNA During 2017
sa32205 Nonsense Available for shipment Available now
sa23295 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32204
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Nonsense 72 4812 2 81
ENSDART00000100830   None 140 None 4
ENSDART00000136934   None 582 None 11
ENSDART00000139351   None 268 None 4
ENSDART00000142807   None 161 None 2
ENSDART00000143265   None 1388 None 24
ENSDART00000147321 Nonsense 72 1146 2 21
Genomic Location (Zv9):
Chromosome 18 (position 21057182)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21287405
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTAACCACAGAAGAGCGATTATCAAACACATTTGAGATGCGTCCGCCT[C/T]GAATCTTGGAGCTCTTAGACATGAGCGAAACCACACATCACAAGGTAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43099
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Nonsense 168 4812 4 81
ENSDART00000100830   None 140 None 4
ENSDART00000136934   None 582 None 11
ENSDART00000139351   None 268 None 4
ENSDART00000142807   None 161 None 2
ENSDART00000143265   None 1388 None 24
ENSDART00000147321 Nonsense 168 1146 4 21
Genomic Location (Zv9):
Chromosome 18 (position 21060711)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21290934
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAAGTGGCTCCAGGCATGGCATCTACATTCACCATTCTCTTCACTCCA[C/T]AAGAGAACAAGGTAAATTTGTTAGTTCCAATAGAAATGCAATTGACGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43100
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Essential Splice Site 238 4812 5 81
ENSDART00000100830   None 140 None 4
ENSDART00000136934   None 582 None 11
ENSDART00000139351   None 268 None 4
ENSDART00000142807   None 161 None 2
ENSDART00000143265   None 1388 None 24
ENSDART00000147321 Essential Splice Site 238 1146 5 21
Genomic Location (Zv9):
Chromosome 18 (position 21063149)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21293372
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTACGAAACATAGGAAATTGTGAGGCTAAATTCAAGCTTAGCACATGCAG[G/A]TAAGAGAGCAGCGTCAGTGCAAATTGCTTTGACATTGTAGTACGAAGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17962
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Nonsense 1015 4812 20 81
ENSDART00000100830 Nonsense 29 140 2 4
ENSDART00000136934   None 582 None 11
ENSDART00000139351   None 268 None 4
ENSDART00000142807   None 161 None 2
ENSDART00000143265   None 1388 None 24
ENSDART00000147321   None 1146 None 21
Genomic Location (Zv9):
Chromosome 18 (position 21111712)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21341935
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTGAGTGTTTWATAAATTGCAGGTGGTTACAGAGAAGCTTGTATGCTA[T/A]GCTGTTATCGGGAGGCAATATGTGAGGGAGTGCATCATCACTGCAGACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10786
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Essential Splice Site 1054 4812 20 81
ENSDART00000100830 Essential Splice Site 68 140 2 4
ENSDART00000136934   None 582 None 11
ENSDART00000139351   None 268 None 4
ENSDART00000142807   None 161 None 2
ENSDART00000143265   None 1388 None 24
ENSDART00000147321   None 1146 None 21
Genomic Location (Zv9):
Chromosome 18 (position 21111830)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21342053
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCCAGCAGTTGAGATCTCCTCCCAGCAACTYAACTTCTATGTAGAAAAG[G/A]TTTGCAAAAAAGAATTTTATGWTAATTTATTTACAAATTTATTTTAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36644
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Nonsense 1072 4812 21 81
ENSDART00000100830 Nonsense 86 140 3 4
ENSDART00000136934   None 582 None 11
ENSDART00000139351   None 268 None 4
ENSDART00000142807   None 161 None 2
ENSDART00000143265   None 1388 None 24
ENSDART00000147321 Nonsense 1011 1146 20 21
Genomic Location (Zv9):
Chromosome 18 (position 21117095)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21347318
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCGATGCTTCTCTGGTTCCACTATATGAGAGGCTTATTCTGAAGAGTT[T/A]GTCCTCCTTGAACCTCTCTATGGAACTGCTAGTGCACGAGCCCTTTGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12926
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Nonsense 1195 4812 22 81
ENSDART00000100830   None 140 None 4
ENSDART00000136934   None 582 None 11
ENSDART00000139351   None 268 None 4
ENSDART00000142807   None 161 None 2
ENSDART00000143265   None 1388 None 24
ENSDART00000147321 Nonsense 1134 1146 21 21
Genomic Location (Zv9):
Chromosome 18 (position 21119089)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21349312
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGCAAGCTCACTATGACCAACTGYAGCCCACKCTGCGTTTCATATCGTT[G/A]GGCCTTCCTGGTGGACCAACAACAGTGCCATAYTGGGTAGGAACAGCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43101
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Nonsense 1279 4812 24 81
ENSDART00000100830   None 140 None 4
ENSDART00000136934   None 582 None 11
ENSDART00000139351   None 268 None 4
ENSDART00000142807   None 161 None 2
ENSDART00000143265   None 1388 None 24
ENSDART00000147321   None 1146 None 21
Genomic Location (Zv9):
Chromosome 18 (position 21125166)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21355389
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCATCATGGTAGCTCCAATGGAAATGAGCAAAATAGGACCTGCTTAACA[C/T]GAAGAAGCAAAGAGCTGGGAAGCAAACCCATCAATCTCACAGCCAACGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12486
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Essential Splice Site 1303 4812 24 81
ENSDART00000100830   None 140 None 4
ENSDART00000136934   None 582 None 11
ENSDART00000139351   None 268 None 4
ENSDART00000142807   None 161 None 2
ENSDART00000143265   None 1388 None 24
ENSDART00000147321   None 1146 None 21
Genomic Location (Zv9):
Chromosome 18 (position 21125242)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21355465
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCCATCAATCTCAMAGYCAAYGGGCATCCGAGTGTGGRTGTGAAAGAGG[T/C]TGGTTTAAAGCCCAAATATACTACAGTTTTTTTNNACATATGTTTATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39199
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Essential Splice Site 1886 4812 36 81
ENSDART00000100830   None 140 None 4
ENSDART00000136934   None 582 None 11
ENSDART00000139351   None 268 None 4
ENSDART00000142807   None 161 None 2
ENSDART00000143265   None 1388 None 24
ENSDART00000147321   None 1146 None 21
Genomic Location (Zv9):
Chromosome 18 (position 21140721)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21370944
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTGTGGCAGAATTCAAAGGTAATCTAAAAGTTCTCACCTCTTTTTTAA[G/T]AATCCACAGAAGGTCTTGCAGAAGGAGACAAGGGGGAAACAGATGCACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43102
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Nonsense 1929 4812 37 81
ENSDART00000100830   None 140 None 4
ENSDART00000136934   None 582 None 11
ENSDART00000139351 Nonsense 18 268 1 4
ENSDART00000142807   None 161 None 2
ENSDART00000143265   None 1388 None 24
ENSDART00000147321   None 1146 None 21
Genomic Location (Zv9):
Chromosome 18 (position 21140957)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21371180
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACCTAAGGGCAACAGCAGTGTTGTCACTGCAGTGGGGGATTTGGAATA[T/G]GACCCTGTATCTACAGCTGTCGCACGTTACATGGGCATCGATCTTTCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36645
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Essential Splice Site 2089 4812 38 81
ENSDART00000100830   None 140 None 4
ENSDART00000136934   None 582 None 11
ENSDART00000139351 Essential Splice Site 178 268 2 4
ENSDART00000142807   None 161 None 2
ENSDART00000143265   None 1388 None 24
ENSDART00000147321   None 1146 None 21
Genomic Location (Zv9):
Chromosome 18 (position 21143108)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21373331
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAGGACGTTCACAGAAGAATGACAGCTCCAATCCTGCTGCCTCAGTGG[T/C]AAACACTTATTAATTTGGCACATACAATACACACAGTAGTAGAGGTAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43103
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Nonsense 2216 4812 41 81
ENSDART00000100830   None 140 None 4
ENSDART00000136934   None 582 None 11
ENSDART00000139351   None 268 None 4
ENSDART00000142807   None 161 None 2
ENSDART00000143265   None 1388 None 24
ENSDART00000147321   None 1146 None 21
Genomic Location (Zv9):
Chromosome 18 (position 21147573)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21377796
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCAAGAGAAGAGCAAATGACTCCTAGTGAAGATTGGGATACCACCCCA[C/T]GACCTGAAGACCCTGTGCCCCTCTCTGAGGATGTAAAACAAGAGCTGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29030
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Nonsense 2296 4812 42 81
ENSDART00000100830   None 140 None 4
ENSDART00000136934   None 582 None 11
ENSDART00000139351   None 268 None 4
ENSDART00000142807 Nonsense 65 161 1 2
ENSDART00000143265   None 1388 None 24
ENSDART00000147321   None 1146 None 21
Genomic Location (Zv9):
Chromosome 18 (position 21147993)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21378216
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGACATCACCGATTGTCCTCCATCTTCTGCAAAGAAGACCAAGAAGGAA[C/T]GAGAAAAGGAGAAAGCTGAGAGGGAAAAGTTAAAGGTTGATTCTGAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43104
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Nonsense 2420 4812 43 81
ENSDART00000100830   None 140 None 4
ENSDART00000136934   None 582 None 11
ENSDART00000139351   None 268 None 4
ENSDART00000142807   None 161 None 2
ENSDART00000143265   None 1388 None 24
ENSDART00000147321   None 1146 None 21
Genomic Location (Zv9):
Chromosome 18 (position 21148453)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21378676
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCAGCAACTACTTTACATTTTTGAAGCCCATATCTTGTGAGGACCTGT[C/A]AGAGAAAGAAAAAGAACTCGGATCAGAAACTGTCAAGGTACTAAAATATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8483
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Essential Splice Site 2456 4812 44 81
ENSDART00000100830   None 140 None 4
ENSDART00000136934   None 582 None 11
ENSDART00000139351   None 268 None 4
ENSDART00000142807   None 161 None 2
ENSDART00000143265   None 1388 None 24
ENSDART00000147321   None 1146 None 21
Genomic Location (Zv9):
Chromosome 18 (position 21150032)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21380255
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCCAACCCTGGCCAGTCTGAGGAGCCCAAMCCAGAATATAACCAAGGG[T/A]ATARGAGATTCCYTATGCAWATRAAAGCATKTAAAATCACWAATAAATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17202
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Nonsense 2524 4812 46 81
ENSDART00000100830   None 140 None 4
ENSDART00000136934   None 582 None 11
ENSDART00000139351   None 268 None 4
ENSDART00000142807   None 161 None 2
ENSDART00000143265 Nonsense 69 1388 2 24
ENSDART00000147321   None 1146 None 21
Genomic Location (Zv9):
Chromosome 18 (position 21150419)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21380642
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAACTTAGTWGCCTTTTTTGTGTGTAATAGGATTCTGTTTGCCCACTGC[A/T]AAAAGAYACTGCRTCCKGAGAGTRGACTACAGAASACTTACRTTATCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25063
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Nonsense 2794 4812 51 81
ENSDART00000100830   None 140 None 4
ENSDART00000136934   None 582 None 11
ENSDART00000139351   None 268 None 4
ENSDART00000142807   None 161 None 2
ENSDART00000143265 Nonsense 339 1388 7 24
ENSDART00000147321   None 1146 None 21
Genomic Location (Zv9):
Chromosome 18 (position 21154040)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21384263
KASP Assay ID:
554-7447.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACATTCAAAGTGTCAGAAGAAGTCAAGCGGTCTATTAAGTTAGAAAAC[A/T]AGGGCAAATATGACATAGCATTTAAGTAAGTTATGTAGATATTTAATCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43105
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Nonsense 2842 4812 52 81
ENSDART00000100830   None 140 None 4
ENSDART00000136934   None 582 None 11
ENSDART00000139351   None 268 None 4
ENSDART00000142807   None 161 None 2
ENSDART00000143265 Nonsense 387 1388 8 24
ENSDART00000147321   None 1146 None 21
Genomic Location (Zv9):
Chromosome 18 (position 21154271)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21384494
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGCTCTCTACGCCCCAACAATAAACCCACCACTGTCCAGATTATTTAT[C/T]AAAACGACAAAGAAATGTCCATCAGAGATAGCCCAATCCTTTGTTGTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16299
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297   3230 4812 58 81
ENSDART00000100830   None 140 None 4
ENSDART00000136934   None 582 None 11
ENSDART00000139351   None 268 None 4
ENSDART00000142807   None 161 None 2
ENSDART00000143265 Splice Site, Nonsense 775 1388 14 24
ENSDART00000147321   None 1146 None 21
Genomic Location (Zv9):
Chromosome 18 (position 21158691)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21388914
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGGCAAACTCTTCCATTAGTGATCAAGAACAACAGCAATGTGCCTGCA[C/T]AAGTAAGATAAGAATTTGTTTGACTAAACTACAGTTTATATGACTTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12927
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Nonsense 3337 4812 60 81
ENSDART00000100830   None 140 None 4
ENSDART00000136934   None 582 None 11
ENSDART00000139351   None 268 None 4
ENSDART00000142807   None 161 None 2
ENSDART00000143265 Nonsense 858 1388 16 24
ENSDART00000147321   None 1146 None 21
Genomic Location (Zv9):
Chromosome 18 (position 21159569)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21389792
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGTTACCATGACATTATCATTCTGGAGAACGTTGGCAACAGAGTTCAG[C/T]AGGAAAGCACTGAAAGTAAGTGACAATGAATTTTTCAAACATTCTAAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14679
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Nonsense 4004 4812 71 81
ENSDART00000100830   None 140 None 4
ENSDART00000136934   None 582 None 11
ENSDART00000139351   None 268 None 4
ENSDART00000142807   None 161 None 2
ENSDART00000143265   None 1388 None 24
ENSDART00000147321   None 1146 None 21
Genomic Location (Zv9):
Chromosome 18 (position 21170002)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21400225
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTCAGCTGTAGCTCCAGATCTGGAATTTTCTTCCCTCAAGCATAATTTT[G/T]GACTGCAATTCACATATTGTTCTGGTATGGTCCCTGCTACACACACACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43106
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Nonsense 4114 4812 73 81
ENSDART00000100830   None 140 None 4
ENSDART00000136934   None 582 None 11
ENSDART00000139351   None 268 None 4
ENSDART00000142807   None 161 None 2
ENSDART00000143265   None 1388 None 24
ENSDART00000147321   None 1146 None 21
Genomic Location (Zv9):
Chromosome 18 (position 21170492)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21400715
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATTGATTTAGAGGACCCGGCACACAGAGTGGTCAATTTTGGAGCTTTG[C/T]AGATTGGCCAGCAAAGTCGGAAATTGGTTTCCCTTGTGAATAACAGCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32205
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Nonsense 4158 4812 74 81
ENSDART00000100830   None 140 None 4
ENSDART00000136934   None 582 None 11
ENSDART00000139351   None 268 None 4
ENSDART00000142807   None 161 None 2
ENSDART00000143265   None 1388 None 24
ENSDART00000147321   None 1146 None 21
Genomic Location (Zv9):
Chromosome 18 (position 21171898)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21402121
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAACAATTTTTTTTTCTCCCTTCAGATCTTGTCAGTGCGTCCAGATGGC[C/T]AGGTAACACTTAAAGAGGGAGGTGGCCGCTGTGCGGTTGAGCTTCTCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23295
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Nonsense 4369 4812 76 81
ENSDART00000100830   None 140 None 4
ENSDART00000136934   None 582 None 11
ENSDART00000139351   None 268 None 4
ENSDART00000142807   None 161 None 2
ENSDART00000143265   None 1388 None 24
ENSDART00000147321   None 1146 None 21
Genomic Location (Zv9):
Chromosome 18 (position 21175136)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21405359
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGCGGGCCACCCACTCTCCTCACTGAGCCTACTCAACAGAACACCTA[T/A]GAGATCACATACAAGCCGCTGGTCATGACTACTGATGGGGAGAAGCATGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link