ela2

Ensembl ID:
ENSDARG00000056744
ZFIN ID:
ZDB-GENE-041117-1
Description:
elastase 2 [Source:RefSeq peptide;Acc:NP_001132936]
Human Orthologue:
CTRC
Human Description:
chymotrypsin C (caldecrin) [Source:HGNC Symbol;Acc:2523]
Mouse Orthologues:
Cela3b, Ctrc, Gm13011
Mouse Descriptions:
chymotrypsin C (caldecrin) Gene [Source:MGI Symbol;Acc:MGI:1923951]
chymotrypsin-like elastase family, member 3B Gene [Source:MGI Symbol;Acc:MGI:1915118]
predicted gene 13011 Gene [Source:MGI Symbol;Acc:MGI:3651647]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31650 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31650
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079267 Nonsense 72 271 4 9
ENSDART00000124029 Nonsense 109 307 3 8
ENSDART00000136765 Nonsense 68 266 3 8
Genomic Location (Zv9):
Chromosome 8 (position 21917567)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 21347464
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCTTTTACCACACCTGTGGTGGCACCTTGATCGACAAGCAGTGGGTCT[T/A]GACCGCTGCTCACTGCATTAGGTAAAAAAAAAACAGCTACTCTTTCTCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link