crmp1

Ensembl ID:
ENSDARG00000056742
ZFIN ID:
ZDB-GENE-050720-1
Description:
collapsin response mediator protein 1 [Source:RefSeq peptide;Acc:NP_001018561]
Human Orthologue:
CRMP1
Human Description:
collapsin response mediator protein 1 [Source:HGNC Symbol;Acc:2365]
Mouse Orthologue:
Crmp1
Mouse Description:
collapsin response mediator protein 1 Gene [Source:MGI Symbol;Acc:MGI:107793]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19452 Nonsense Mutation detected in F1 DNA During 2016
sa31199 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa19452
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064468   None 575 None 14
ENSDART00000098095 Nonsense 17 674 1 14
Genomic Location (Zv9):
Chromosome 1 (position 13228251)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 13656993
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTCGGACTATAGGCGACAGTGGAACCGGGAGGATGAACTCCCGGTATA[T/A]CTGGCAAAGCCCATCTCGGCGGGCAACCAGCGGCAGAAGTCTCACGGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31199
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064468 Essential Splice Site 373 575 10 14
ENSDART00000098095 Essential Splice Site 472 674 10 14
Genomic Location (Zv9):
Chromosome 1 (position 13245589)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 13674331
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACCAACGGAGTGGAGGAGAGAATGGGGTTTGTTTGGGATAAAGCTGTG[G/A]TAAGTGCATGTCTATGAATTGTGGCTACAGGTCGCATTCATTATTCATCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link