crmp1

Ensembl ID:
ENSDARG00000056742
ZFIN ID:
ZDB-GENE-050720-1
Description:
collapsin response mediator protein 1 [Source:RefSeq peptide;Acc:NP_001018561]
Human Orthologue:
CRMP1
Human Description:
collapsin response mediator protein 1 [Source:HGNC Symbol;Acc:2365]
Mouse Orthologue:
Crmp1
Mouse Description:
collapsin response mediator protein 1 Gene [Source:MGI Symbol;Acc:MGI:107793]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19452 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19452
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064468 None None 575 None 14
ENSDART00000098095 Nonsense 17 674 1 14
Genomic Location:
Chromosome 1 (position 13228251)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTCGGACTATAGGCGACAGTGGAACCGGGAGGATGAACTCCCGGTATA[T/A]CTGGCAAAGCCCATCTCGGCGGGCAACCAGCGGCAGAAGTCTCACGGAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/plp9r75r