tmeff1

Ensembl ID:
ENSDARG00000056740
ZFIN ID:
ZDB-GENE-050706-143
Description:
tomoregulin-1 [Source:RefSeq peptide;Acc:NP_001020472]
Human Orthologues:
RP11-61P7.3, TMEFF1
Human Descriptions:
C9orf30-TMEFF1 fusion protein [Source:RefSeq peptide;Acc:NP_001185741]
transmembrane protein with EGF-like and two follistatin-like domains 1 [Source:HGNC Symbol;Acc:11866
Mouse Orthologue:
Tmeff1
Mouse Description:
transmembrane protein with EGF-like and two follistatin-like domains 1 Gene [Source:MGI Symbol;Acc:M

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13166 Nonsense Available for shipment Available now
sa12216 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13166
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079283 Nonsense 110 364 3 10
Genomic Location:
Chromosome 24 (position 34985637)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGCTCGAAGAAYTACATCCCKGTGTGCGGCACAAACGGAGACACCTAT[C/T]AGAAYGAGTGCTATCTGAAACAAGCAGCCTGWAACCAGCAGAAATCCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12216
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079283 Nonsense 120 364 3 10
Genomic Location:
Chromosome 24 (position 34985605)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAAACGGAGACACCTATYAGAAYGAGTGCTATCTGAAACAAGCAGCCTG[T/A]AACCAGCAGAAATCCATCGTTCTGGCCAATGARGGCCCTTGCGATCCTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/08bp9lhe