tas1r1

Ensembl ID:
ENSDARG00000056739
ZFIN ID:
ZDB-GENE-060208-2
Description:
taste receptor type 1 member 1 [Source:RefSeq peptide;Acc:NP_001034614]
Human Orthologue:
TAS1R1
Human Description:
taste receptor, type 1, member 1 [Source:HGNC Symbol;Acc:14448]
Mouse Orthologue:
Tas1r1
Mouse Description:
taste receptor, type 1, member 1 Gene [Source:MGI Symbol;Acc:MGI:1927505]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16836 Nonsense Available for shipment Available now
sa43966 Nonsense Mutation detected in F1 DNA During 2016
sa17292 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16836
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104214 Nonsense 291 821 3 7
ENSDART00000135440 Nonsense 287 430 3 4
Genomic Location (Zv9):
Chromosome 23 (position 21726953)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21506260
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACGYGACGGGTAAAGTGTGGATTGGGACAGAGGACTGGTCAGTGGCGT[C/A]GACGGYTAGTAGTATTCCAGGAATCAGYATGAWAGGGACAGTCATTGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43966
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104214 Nonsense 401 821 4 7
ENSDART00000135440 Nonsense 397 430 4 4
Genomic Location (Zv9):
Chromosome 23 (position 21727373)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21506680
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGTGTTTGTGTTATTTGTGACACCATGTTTAAAATCCCTCAGGTTTA[T/A]GAGCAGCTGAGACAAGTGCGCTTTTCCATCCGAAATGCATCATTTTACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17292
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104214 Nonsense 464 821 4 7
ENSDART00000135440   None 430 None 4
Genomic Location (Zv9):
Chromosome 23 (position 21727562)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21506869
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACAGTCCTRGTGYCAATGATCTTCATTTAGACGACTCTCAGATTGACTG[G/A]TCAGGACAAGTGTCTCCTGTAACCAATGTAAGTTTGTATTTTTCATATTCNNN
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link