tas1r1

Ensembl ID:
ENSDARG00000056739
ZFIN ID:
ZDB-GENE-060208-2
Description:
taste receptor type 1 member 1 [Source:RefSeq peptide;Acc:NP_001034614]
Human Orthologue:
TAS1R1
Human Description:
taste receptor, type 1, member 1 [Source:HGNC Symbol;Acc:14448]
Mouse Orthologue:
Tas1r1
Mouse Description:
taste receptor, type 1, member 1 Gene [Source:MGI Symbol;Acc:MGI:1927505]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8008 Nonsense Mutation detected in F1 DNA During 2014
sa16836 Nonsense Available for shipment Available now
sa17292 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8008
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104214 Nonsense 241 821 3 7
ENSDART00000135440 Nonsense 237 430 3 4
Genomic Location:
Chromosome 23 (position 21726802)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATACCAAGCCCAGRWCCCTGCGGTAACAGACAGCACAAAGAAATACATG[C/T]AAGACATGGTCAAAAACATCCTCAAAACTAAAGTCAACACTATAGTTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16836
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104214 Nonsense 291 821 3 7
ENSDART00000135440 Nonsense 287 430 3 4
Genomic Location:
Chromosome 23 (position 21726953)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACGYGACGGGTAAAGTGTGGATTGGGACAGAGGACTGGTCAGTGGCGT[C/A]GACGGYTAGTAGTATTCCAGGAATCAGYATGAWAGGGACAGTCATTGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17292
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104214 Nonsense 464 821 4 7
ENSDART00000135440 None None 430 None 4
Genomic Location:
Chromosome 23 (position 21727562)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACAGTCCTRGTGYCAATGATCTTCATTTAGACGACTCTCAGATTGACTG[G/A]TCAGGACAAGTGTCTCCTGTAACCAATGTAAGTTTGTATTTTTCATATTCNNN
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6q4j0g41