mtmr1a

Ensembl ID:
ENSDARG00000056690
ZFIN ID:
ZDB-GENE-050522-518
Description:
myotubularin related protein 1a [Source:RefSeq peptide;Acc:NP_001018557]
Human Orthologue:
MTMR1
Human Description:
myotubularin related protein 1 [Source:HGNC Symbol;Acc:7449]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1365 Nonsense Available for shipment Available now
sa20936 Splice Site, Nonsense Mutation detected in F1 DNA During 2014
sa20937 Nonsense Mutation detected in F1 DNA During 2014
sa10980 Nonsense Available for shipment Available now
sa20938 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa1365
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079218 Nonsense 87 683 3 16
ENSDART00000100369 None None 505 None 13
Genomic Location:
Chromosome 7 (position 26987242)
KASP Assay ID:
554-1277.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTGTCTTGCGGATGATGCTCAGTCTCAGGACTCTGGTGAAGATGGCTG[T/A]CAGTTTGACAGTGATTGTGAACTGCCGTCTCACACTTCGGCAAGTTTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20936
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079218 Splice Site, Nonsense 101 683 4 16
ENSDART00000100369 None None 505 None 13
Genomic Location:
Chromosome 7 (position 26989141)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCCAGCACTTCTCAAAAGAACATTCTGTGTTGTTTTTATGTTTCATAG[C/T]AAGTATTCAGGGATGTACGACGGCCGGCCCCAATGGATGAAGTCCCATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20937
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079218 Nonsense 107 683 4 16
ENSDART00000100369 None None 505 None 13
Genomic Location:
Chromosome 7 (position 26989159)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAACATTCTGTGTTGTTTTTATGTTTCATAGCAAGTATTCAGGGATGTA[C/T]GACGGCCGGCCCCAATGGATGAAGTCCCATTGGTCCCTGGAGAGACAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10980
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079218 Nonsense 134 683 5 16
ENSDART00000100369 Nonsense 11 505 2 13
Genomic Location:
Chromosome 7 (position 26989331)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCATCTGTTATCTTCTGTCTCTGCAGTTAAAGATGTGATGTATATCTG[T/A]CCTTTCACTGGAGCCGTGACCGGCACACTCACWATCACAGACTACAAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20938
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079218 Essential Splice Site 256 683 8 16
ENSDART00000100369 Essential Splice Site 133 505 5 13
Genomic Location:
Chromosome 7 (position 26993125)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGGATGGATGGAAGGTTTATGATCCAGTGGCCGAGTATAAAAGAATGG[T/A]GAGACATGCACATTGCTGAAAAACAGTAGAGTTGACTGAATACATTGAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5pabwrtb