FYCO1 (1 of 2)

Ensembl ID:
ENSDARG00000056689
Description:
FYVE and coiled-coil domain containing 1 [Source:HGNC Symbol;Acc:14673]
Human Orthologue:
FYCO1
Human Description:
FYVE and coiled-coil domain containing 1 [Source:HGNC Symbol;Acc:14673]
Mouse Orthologue:
Fyco1
Mouse Description:
FYVE and coiled-coil domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:107277]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24397 Nonsense Mutation detected in F1 DNA During 2014
sa15873 Nonsense Available for shipment Available now
sa6752 Essential Splice Site Mutation detected in F1 DNA During 2014
sa24398 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24397
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111043 Nonsense 573 1497 7 17
Genomic Location:
Chromosome 23 (position 40285255)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCCAAGAAGATTGATGAATACAAGGATAGCTGCGCCAAGCTTATTGAG[C/T]AAAACACTAAGCTTCTGCAGACGGTGAATAAGAATGAAGAGAGCAAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15873
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111043 Nonsense 1172 1497 11 17
Genomic Location:
Chromosome 23 (position 40303825)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACAACCAGTCTTTACTCATTTYTCTTTTCAGAGATAAGGACGCTCTGTG[G/A]CAGAAGTCTGAYGCTCTAGAGTTCGAGCAGAARCTAAGAGCAGAGGAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6752
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111043 Essential Splice Site 1335 1497 13 17
Genomic Location:
Chromosome 23 (position 40315715)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACCACCAATGGATCACATGAGGAGGAAGGAGGACAAACCGGAGATAAG[T/A]AAGTSTGTAAACACACAAAATAATGTCATACAGTTTTATGCAAAAGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24398
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111043 Essential Splice Site 1436 1497 15 17
Genomic Location:
Chromosome 23 (position 40327175)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACTGTGGTGTACAGAGAGACACTTGACACACCTGTCGAGCAGGCCAAG[G/A]TAACAAACACACACATGCAAGACATTCAGAGGGTGTTGAGTGTGTCTTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jcc5b6uc