cdk5

Ensembl ID:
ENSDARG00000056683
ZFIN ID:
ZDB-GENE-010131-2
Description:
cell division protein kinase 5 [Source:RefSeq peptide;Acc:NP_571794]
Human Orthologue:
CDK5
Human Description:
cyclin-dependent kinase 5 [Source:HGNC Symbol;Acc:1774]
Mouse Orthologue:
Cdk5
Mouse Description:
cyclin-dependent kinase 5 Gene [Source:MGI Symbol;Acc:MGI:101765]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8373 Essential Splice Site Mutation detected in F1 DNA During 2014
sa5702 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8373
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079210 None None 292 None 12
ENSDART00000128679 Essential Splice Site None 292 13 13
ENSDART00000134707 None None 292 None 13
ENSDART00000079210 None None 292 None 12
ENSDART00000128679 Essential Splice Site None 292 13 13
ENSDART00000134707 None None 292 None 13
Genomic Location:
Chromosome 24 (position 34834816)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCCAAACTTGACTATTTYAAGACGGTGAAGGAAATTTCAGGTAAAAAT[T/G]ATTTACTTATATTTTTAAAAATTGCATTTAAATATTTATTTTCGTTATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5702
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079210 None None 292 None 12
ENSDART00000128679 Essential Splice Site None 292 13 13
ENSDART00000134707 None None 292 None 13
ENSDART00000079210 None None 292 None 12
ENSDART00000128679 Essential Splice Site None 292 13 13
ENSDART00000134707 None None 292 None 13
Genomic Location:
Chromosome 24 (position 34834816)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCCAAACTTGACTATTTCAAGACGGTGAAGGAAATTTCAGGTAAAAAT[T/G]ATTTACTTATATTTTTAAAAATTGCATTTAAATATTTATTTTCGTTATGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/sot5lab1