morc3a

Ensembl ID:
ENSDARG00000056679
ZFIN ID:
ZDB-GENE-030131-1502
Description:
MORC family CW-type zinc finger protein 3 [Source:RefSeq peptide;Acc:NP_001082835]
Human Orthologue:
MORC3
Human Description:
MORC family CW-type zinc finger 3 [Source:HGNC Symbol;Acc:23572]
Mouse Orthologue:
Morc3
Mouse Description:
microrchidia 3 Gene [Source:MGI Symbol;Acc:MGI:2136841]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17512 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17512
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101085 Nonsense 900 1079 17 19

The following transcripts of ENSDARG00000056679 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 31595942)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAAAGGAAAGAGGAGGCCTTGCTYAAAGGCAAAGCTGAGAAAGAGGYG[C/T]AGGACGAGGTGTGTCGTGAGCGRTTGAAAGCTGAGAGTGAGGGACACTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jq3okdrm