Q566S0_DANRE

Ensembl ID:
ENSDARG00000056677
Description:
LOC553528 protein [Source:UniProtKB/TrEMBL;Acc:Q566S0]
Human Orthologues:
OCIAD1, OCIAD2
Human Descriptions:
OCIA domain containing 1 [Source:HGNC Symbol;Acc:16074]
OCIA domain containing 2 [Source:HGNC Symbol;Acc:28685]
Mouse Orthologues:
Ociad1, Ociad2
Mouse Descriptions:
OCIA domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1915345]
OCIA domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1916377]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25545 Nonsense Mutation detected in F1 DNA During 2017
sa39572 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25545
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123895 Nonsense 87 239 5 9
Genomic Location (Zv9):
Chromosome 1 (position 13308566)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 13737308
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAACATTTGTATGTGTTAAATAAATGTTAGTTGCTGGTTTTTGTGGCTA[T/A]GTTGGAGGAAAGATGTCATACATGAAGAAATGCATTGAGAAGTTTAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39572
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123895 Nonsense 118 239 5 9
Genomic Location (Zv9):
Chromosome 1 (position 13308475)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 13737217
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTTAAGAACTTGGAGAATTCACCTCTTGGAGAGGCACTGAGACAGCAA[C/T]AGCGCCACCAACATCAAAAGTGAGAAACACACACAAACAGACACAACTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link