nsun2

Ensembl ID:
ENSDARG00000056665
ZFIN ID:
ZDB-GENE-030131-4017
Description:
tRNA (cytosine-5-)-methyltransferase NSUN2 [Source:RefSeq peptide;Acc:NP_956005]
Human Orthologue:
NSUN2
Human Description:
NOP2/Sun domain family, member 2 [Source:HGNC Symbol;Acc:25994]
Mouse Orthologue:
Nsun2
Mouse Description:
NOL1/NOP2/Sun domain family member 2 Gene [Source:MGI Symbol;Acc:MGI:107252]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3016 Nonsense F2 line generated During 2017
sa14653 Nonsense Available for shipment Available now
sa15958 Essential Splice Site Available for shipment Available now
sa36858 Essential Splice Site Mutation detected in F1 DNA During 2017
sa43300 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa3016
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079181 Nonsense 67 706 4 19
ENSDART00000140336 Nonsense 127 766 4 19

The following transcripts of ENSDARG00000056665 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 28347070)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 28277182
KASP Assay ID:
554-2846.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGTCATTGTAGGTATCCTGATGAACTGGCATGGCATACAAATCTGAGC[A/T]GAAAGATCCTCCGCAAATCTCCCCTTCTGGAGAAATTCCACCAGTTCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14653
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079181 Nonsense 122 706 6 19
ENSDART00000140336 Nonsense 182 766 6 19

The following transcripts of ENSDARG00000056665 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 28349277)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 28279389
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTCTTYATGAATTTNTAWATSTAGATTCTGGACATGTGTGCGGCTCCA[G/T]GATCAAAGACGGCTCAACTAATAGAGATGCTACACTCTGACATGGATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15958
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079181 Essential Splice Site 142 706 6 19
ENSDART00000140336 Essential Splice Site 202 766 6 19

The following transcripts of ENSDARG00000056665 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 28349339)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 28279451
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCAACTAATAGAGATGCTACACTCTGACATGGATGTGCCTTTCCCTGG[T/G]AAACCTTTATTAATATTCANTTTTTTATGATRAAGTGAGTACTKTTGTST
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36858
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079181 Essential Splice Site 299 706 10 19
ENSDART00000140336 Essential Splice Site 359 766 10 19

The following transcripts of ENSDARG00000056665 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 28357965)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 28288077
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAGATCTCCCAGGACTCAAATATATGCCTGGAATTACATCTTGGAAAG[T/G]AATGAACTGAACTCAACTCTGATACGAATTAGATTTTGCATAGGTTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43300
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079181 Essential Splice Site 516 706 16 19
ENSDART00000140336 Essential Splice Site 576 766 16 19

The following transcripts of ENSDARG00000056665 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 28373034)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 28303146
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAGATAGGTTTTTTTGTTTGTTCATGTCTGAATTGCCTTTATTTCTGCA[G/A]GTTATAAACACAGGAGTGAAAGTCTTGTCCAGAAATAATGATGGAGAACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link