arfip2b

Ensembl ID:
ENSDARG00000056664
ZFIN ID:
ZDB-GENE-050417-131
Description:
ADP-ribosylation factor interacting protein 2b [Source:RefSeq peptide;Acc:NP_001017649]
Human Orthologue:
ARFIP2
Human Description:
ADP-ribosylation factor interacting protein 2 [Source:HGNC Symbol;Acc:17160]
Mouse Orthologue:
Arfip2
Mouse Description:
ADP-ribosylation factor interacting protein 2 Gene [Source:MGI Symbol;Acc:MGI:1924182]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13726 Essential Splice Site Available for shipment Available now
sa17908 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13726
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079194 Essential Splice Site 33 355 2 9
ENSDART00000130920 Essential Splice Site 33 355 1 8
ENSDART00000132019 Essential Splice Site 33 140 2 6
Genomic Location:
Chromosome 10 (position 26852685)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGTAATGGGGACTCTCGAAATCTGGCAGAAGATGACAGTTTGGAGCAG[G/A]TGAGCAATACATGGTGATTCAGTAAAACTGGAACAGTTTTTTTTTTTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17908
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079194 Essential Splice Site 194 355 7 9
ENSDART00000130920 Essential Splice Site 194 355 6 8
ENSDART00000132019 None None 140 None 6
Genomic Location:
Chromosome 10 (position 26842467)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATATATTGATRATGTATAATATTGAGGTTTGTGCTATTGTTCATGTAC[A/T]GGATGAGTTTGGATACAATGCAGAAACGCAAAAGTTGTTGTGCAAGAATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/f559sdin