arfip2b

Ensembl ID:
ENSDARG00000056664
ZFIN ID:
ZDB-GENE-050417-131
Description:
ADP-ribosylation factor interacting protein 2b [Source:RefSeq peptide;Acc:NP_001017649]
Human Orthologue:
ARFIP2
Human Description:
ADP-ribosylation factor interacting protein 2 [Source:HGNC Symbol;Acc:17160]
Mouse Orthologue:
Arfip2
Mouse Description:
ADP-ribosylation factor interacting protein 2 Gene [Source:MGI Symbol;Acc:MGI:1924182]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13726 Essential Splice Site Available for shipment Available now
sa17908 Essential Splice Site Available for shipment Available now
sa41668 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa13726
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079194 Essential Splice Site 33 355 2 9
ENSDART00000130920 Essential Splice Site 33 355 1 8
ENSDART00000132019 Essential Splice Site 33 140 2 6
Genomic Location (Zv9):
Chromosome 10 (position 26852685)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26256542
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGTAATGGGGACTCTCGAAATCTGGCAGAAGATGACAGTTTGGAGCAG[G/A]TGAGCAATACATGGTGATTCAGTAAAACTGGAACAGTTTTTTTTTTTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17908
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079194 Essential Splice Site 194 355 7 9
ENSDART00000130920 Essential Splice Site 194 355 6 8
ENSDART00000132019   None 140 None 6
Genomic Location (Zv9):
Chromosome 10 (position 26842467)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26246324
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATATATTGATRATGTATAATATTGAGGTTTGTGCTATTGTTCATGTAC[A/T]GGATGAGTTTGGATACAATGCAGAAACGCAAAAGTTGTTGTGCAAGAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41668
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079194 Nonsense 306 355 9 9
ENSDART00000130920 Nonsense 306 355 8 8
ENSDART00000132019   None 140 None 6
Genomic Location (Zv9):
Chromosome 10 (position 26840693)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26244550
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTGCTTTTTGTTTTCTGACACGGTGTGTTTGTCTCTCTTCTACAGGTC[A/T]AAGTGATGCACAAGCAACTTCTGCTGTTCCATAATGCCATCTCTGCCTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link