TTBK1 (2 of 2)

Ensembl ID:
ENSDARG00000056659
Description:
tau tubulin kinase 1 [Source:HGNC Symbol;Acc:19140]
Human Orthologue:
TTBK1
Human Description:
tau tubulin kinase 1 [Source:HGNC Symbol;Acc:19140]
Mouse Orthologue:
Ttbk1
Mouse Description:
tau tubulin kinase 1 Gene [Source:MGI Symbol;Acc:MGI:2147036]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9312 Nonsense Mutation detected in F1 DNA During 2016
sa36394 Nonsense Mutation detected in F1 DNA During 2016
sa6470 Essential Splice Site Mutation detected in F1 DNA During 2016
sa23059 Nonsense Mutation detected in F1 DNA During 2016
sa36393 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa9312
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114470 Nonsense 222 1219 7 14
Genomic Location (Zv9):
Chromosome 17 (position 21884537)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22034686
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCATACTCTGTTCTTTGTTTTTAACRGGAAATGGGTCGTCATGATGATT[T/A]GYGGTCGTTGTTTTATATGCTGGTAGAGTTTACCGTTGGACAATTACCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36394
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114470 Nonsense 231 1219 7 14
Genomic Location (Zv9):
Chromosome 17 (position 21884511)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22034660
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAAATGGGTCGTCATGATGATTTGTGGTCGTTGTTTTATATGCTGGTA[G/T]AGTTTACCGTTGGACAATTACCATGGCGTAAGATAAAAGATAAGGTAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6470
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114470 Essential Splice Site 245 1219 7 14
Genomic Location (Zv9):
Chromosome 17 (position 21884466)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22034615
KASP Assay ID:
554-4659.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTAGAGTTTACCGTTGGACAATTACCATGGCGTAAGATAAAAGATAAG[G/A]TAAGGCAAATGTATCACGCTCKCATCAACCAGTGACTATGAGCATAATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23059
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114470 Nonsense 902 1219 13 14
Genomic Location (Zv9):
Chromosome 17 (position 21866250)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22016399
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTATAGCTATTAAAGAAAATATTTCAATAGAAACCAAATTAGATGACGAA[C/T]AAGATGGTGTCACAACAGAGAAAGAACAGGAGCAAGAAGAGAGTCCATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36393
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114470 Nonsense 923 1219 13 14
Genomic Location (Zv9):
Chromosome 17 (position 21866187)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22016336
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACAGAGAAAGAACAGGAGCAAGAAGAGAGTCCATCTGTGTCCCCTGAA[C/T]AAAACAGAGATGCTGAAGTAGAGGATGAGAAGGATGTGTCTCCACCAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link