TTBK1 (2 of 2)

Ensembl ID:
ENSDARG00000056659
Description:
tau tubulin kinase 1 [Source:HGNC Symbol;Acc:19140]
Human Orthologue:
TTBK1
Human Description:
tau tubulin kinase 1 [Source:HGNC Symbol;Acc:19140]
Mouse Orthologue:
Ttbk1
Mouse Description:
tau tubulin kinase 1 Gene [Source:MGI Symbol;Acc:MGI:2147036]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45602 Nonsense Mutation detected in F1 DNA During 2018
sa9312 Nonsense Mutation detected in F1 DNA During 2018
sa36394 Nonsense Available for shipment Available now
sa6470 Essential Splice Site Mutation detected in F1 DNA During 2018
sa45601 Essential Splice Site Mutation detected in F1 DNA During 2018
sa23059 Nonsense Available for shipment Available now
sa36393 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45602
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114470 Nonsense 82 1219 2 14
Genomic Location (Zv9):
Chromosome 17 (position 21892292)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22042441
GRCz11 17 22062277
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCTGCCCAACAACCCAAACAAGTGCTAAAGATGGAGGTTGCTGTGCTA[A/T]AGAAACTACAAGGTGAGGAGACGGAGAGGATATATGTGCTGTTTTGTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9312
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114470 Nonsense 222 1219 7 14
Genomic Location (Zv9):
Chromosome 17 (position 21884537)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22034686
GRCz11 17 22054522
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCATACTCTGTTCTTTGTTTTTAACRGGAAATGGGTCGTCATGATGATT[T/A]GYGGTCGTTGTTTTATATGCTGGTAGAGTTTACCGTTGGACAATTACCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36394
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114470 Nonsense 231 1219 7 14
Genomic Location (Zv9):
Chromosome 17 (position 21884511)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22034660
GRCz11 17 22054496
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAAATGGGTCGTCATGATGATTTGTGGTCGTTGTTTTATATGCTGGTA[G/T]AGTTTACCGTTGGACAATTACCATGGCGTAAGATAAAAGATAAGGTAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6470
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114470 Essential Splice Site 245 1219 7 14
Genomic Location (Zv9):
Chromosome 17 (position 21884466)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22034615
GRCz11 17 22054451
KASP Assay ID:
554-4659.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTAGAGTTTACCGTTGGACAATTACCATGGCGTAAGATAAAAGATAAG[G/A]TAAGGCAAATGTATCACGCTCKCATCAACCAGTGACTATGAGCATAATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45601
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114470 Essential Splice Site 287 1219 8 14
Genomic Location (Zv9):
Chromosome 17 (position 21884169)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22034318
GRCz11 17 22054154
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTATGATCATGTGCTGGATTTGGATTATTTCACCAAACCTGATTATCAG[G/A]TAAAGCAATACATACATCTCTTATCTTCTTCTGATTTCACTACCTCATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23059
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114470 Nonsense 902 1219 13 14
Genomic Location (Zv9):
Chromosome 17 (position 21866250)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22016399
GRCz11 17 22036235
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTATAGCTATTAAAGAAAATATTTCAATAGAAACCAAATTAGATGACGAA[C/T]AAGATGGTGTCACAACAGAGAAAGAACAGGAGCAAGAAGAGAGTCCATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36393
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114470 Nonsense 923 1219 13 14
Genomic Location (Zv9):
Chromosome 17 (position 21866187)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22016336
GRCz11 17 22036172
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACAGAGAAAGAACAGGAGCAAGAAGAGAGTCCATCTGTGTCCCCTGAA[C/T]AAAACAGAGATGCTGAAGTAGAGGATGAGAAGGATGTGTCTCCACCAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link