TTBK1 (2 of 2)

Ensembl ID:
ENSDARG00000056659
Description:
tau tubulin kinase 1 [Source:HGNC Symbol;Acc:19140]
Human Orthologue:
TTBK1
Human Description:
tau tubulin kinase 1 [Source:HGNC Symbol;Acc:19140]
Mouse Orthologue:
Ttbk1
Mouse Description:
tau tubulin kinase 1 Gene [Source:MGI Symbol;Acc:MGI:2147036]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7829 Essential Splice Site Mutation detected in F1 DNA During 2014
sa9312 Nonsense Mutation detected in F1 DNA During 2014
sa6470 Essential Splice Site Mutation detected in F1 DNA During 2014
sa4013 Nonsense Mutation detected in F1 DNA During 2014
sa19171 Nonsense Mutation detected in F1 DNA During 2014
sa23059 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7829
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114470 Essential Splice Site 215 1219 7 14
Genomic Location:
Chromosome 17 (position 21884561)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAACAATATAGACAACTACATTTTTCATACTCTGTTCTTTGTTTTTAAC[A/G]GGAAATGGGTCGTCATGATGATTTGYGGTCGTTGTTTTATATGCTGGTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9312
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114470 Nonsense 222 1219 7 14
Genomic Location:
Chromosome 17 (position 21884537)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCATACTCTGTTCTTTGTTTTTAACRGGAAATGGGTCGTCATGATGATT[T/A]GYGGTCGTTGTTTTATATGCTGGTAGAGTTTACCGTTGGACAATTACCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6470
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114470 Essential Splice Site 245 1219 7 14
Genomic Location:
Chromosome 17 (position 21884466)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTAGAGTTTACCGTTGGACAATTACCATGGCGTAAGATAAAAGATAAG[G/A]TAAGGCAAATGTATCACGCTCKCATCAACCAGTGACTATGAGCATAATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4013
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114470 Nonsense 741 1219 13 14
ENSDART00000114470 Nonsense 741 1219 13 14
Genomic Location:
Chromosome 17 (position 21866733)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACCTGGGGATGGGCAGGGAACGCTTGCTGCTTTGACACCGCAGGGAGAG[C/T]GACCTGTGCCRGAAGAATCTGAACCTGGCACYCTTTCCTCTGTCATTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19171
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114470 Nonsense 741 1219 13 14
ENSDART00000114470 Nonsense 741 1219 13 14
Genomic Location:
Chromosome 17 (position 21866733)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCTGGGGATGGGCAGGGAACGCTTGCTGCTTTGACACCGCAGGGAGAG[C/T]GACCTGTGCCAGAAGAATCTGAACCTGGCACTCTTTCCTCTGTCATTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23059
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114470 Nonsense 902 1219 13 14
Genomic Location:
Chromosome 17 (position 21866250)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTATAGCTATTAAAGAAAATATTTCAATAGAAACCAAATTAGATGACGAA[C/T]AAGATGGTGTCACAACAGAGAAAGAACAGGAGCAAGAAGAGAGTCCATCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tvsylhrd