tspan18a

Ensembl ID:
ENSDARG00000056656
ZFIN ID:
ZDB-GENE-040718-232
Description:
tetraspanin 18a [Source:RefSeq peptide;Acc:NP_001002734]
Human Orthologue:
TSPAN18
Human Description:
tetraspanin 18 [Source:HGNC Symbol;Acc:20660]
Mouse Orthologue:
Tspan18
Mouse Description:
tetraspanin 18 Gene [Source:MGI Symbol;Acc:MGI:1917186]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12254 Essential Splice Site Available for shipment Available now
sa40896 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa12254
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079186 Essential Splice Site None 241 2 9
ENSDART00000134717 Essential Splice Site 1 253 2 9
Genomic Location (Zv9):
Chromosome 7 (position 27930043)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26532982
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCAGAAAAGGCAACAGCTGGAAGGGAGAGACATTTACAGGTACATATG[G/A]TATGGTGATTTTTGATCATTTTTAMTCATGCATCAAAATYTGATGGCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40896
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079186 Nonsense 69 241 4 9
ENSDART00000134717 Nonsense 81 253 4 9
Genomic Location (Zv9):
Chromosome 7 (position 27954018)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26556957
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACTGGAGTCTATGCAATTCTGATCATGGGCGGGATGCTGTTCCTACTG[G/T]GATTTCTGGGCTGCTGTGGAGCCATTCGTGAAAATAAATGCCTTCTATTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Schizophrenia: Genome-wide association study identifies a susceptibility locus for schizophrenia in Han Chinese at 11p11.2. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link