GNA15 (2 of 5)

Ensembl ID:
ENSDARG00000056654
Description:
guanine nucleotide binding protein (G protein), alpha 15 (Gq class) [Source:HGNC Symbol;Acc:4383]
Human Orthologue:
GNA15
Human Description:
guanine nucleotide binding protein (G protein), alpha 15 (Gq class) [Source:HGNC Symbol;Acc:4383]
Mouse Orthologue:
Gna15
Mouse Description:
guanine nucleotide binding protein, alpha 15 Gene [Source:MGI Symbol;Acc:MGI:95770]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43832 Nonsense Mutation detected in F1 DNA During 2017
sa37510 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43832
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079178 Nonsense 62 367 2 7
Genomic Location (Zv9):
Chromosome 22 (position 22373614)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 21985250
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGCTTTCATTTAGGTTCTGGAGAAAGTGGAAAGACAACCTTTCTGAAG[C/T]AGATGAGAATCATTCATGGACAGGGCTTCTCAGATGACGAGAGGCATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37510
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079178 Nonsense 100 367 2 7
Genomic Location (Zv9):
Chromosome 22 (position 22373728)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 21985364
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTACCAGAACATCTTCAAGTCTATGCAAGCAATGACAGAAGCCATGAGT[G/T]AGCTAAAGATTCCTTACGCCAATCCACAGAGCGAGGTGATTTAATAAGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Heart failure: Association of genome-wide variation with the risk of incident heart failure in adults of European and African ancestry: a prospective meta-analysis from the cohorts for heart and aging research in genomic epidemiology (CHARGE) consortium. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link