LOC100000058

Ensembl ID:
ENSDARG00000056652
Human Orthologue:
SLC22A7
Human Description:
solute carrier family 22 (organic anion transporter), member 7 [Source:HGNC Symbol;Acc:10971]
Mouse Orthologue:
Slc22a7
Mouse Description:
solute carrier family 22 (organic anion transporter), member 7 Gene [Source:MGI Symbol;Acc:MGI:18595

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14140 Nonsense Available for shipment Available now
sa32149 Nonsense Mutation detected in F1 DNA During 2016
sa36392 Essential Splice Site Mutation detected in F1 DNA During 2016
sa36391 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa14140
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078843 Nonsense 112 551 1 10
Genomic Location:
Chromosome 17 (position 21850894)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACTCGTCCAGCAGCTCAGYTCTTCCAGTAGTGGAGTGTCAGAATGGAT[G/A]GCACTTTGATAAYAGCACCTTCATCAGCACTCTCGCCACACAGGTAAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32149
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078843 Nonsense 325 551 6 10
Genomic Location:
Chromosome 17 (position 21846715)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCAGACTCTGTCCACTGTAGTGACTGTGGATCACCGCGGTCACAGTTA[C/A]ACTTACTTAGACCTAGTAAAAACTCCACAGCTGAGGAAACTCACACTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36392
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078843 Essential Splice Site 347 551 6 10
Genomic Location:
Chromosome 17 (position 21846649)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAAAAACTCCACAGCTGAGGAAACTCACACTCTTCACAGGAATAGTGTG[G/A]TACGTGTTTATGCATGTGCAATTATAAGTACTGTATTTAAAGAAGCAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36391
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078843 Essential Splice Site 418 551 7 10
Genomic Location:
Chromosome 17 (position 21846350)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGGTGCTCACAGGATTCTGCATACTCATCAACATCATCACACCTACAG[G/T]TTTGCAGATACAACGTGTCATTACAGTTTAAAACTAGGCAGCTTTTTAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Urate levels: Genome-wide association analyses identify 18 new loci associated with serum urate concentrations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link