htatsf1

Ensembl ID:
ENSDARG00000056649
ZFIN ID:
ZDB-GENE-040426-1578
Description:
HIV TAT specific factor 1 [Source:RefSeq peptide;Acc:NP_957497]
Human Orthologue:
HTATSF1
Human Description:
HIV-1 Tat specific factor 1 [Source:HGNC Symbol;Acc:5276]
Mouse Orthologue:
Htatsf1
Mouse Description:
HIV TAT specific factor 1 Gene [Source:MGI Symbol;Acc:MGI:1919709]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34918 Nonsense Mutation detected in F1 DNA During 2016
sa13523 Essential Splice Site Available for shipment Available now
sa13135 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34918
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079174 Nonsense 173 450 5 10
Genomic Location (Zv9):
Chromosome 10 (position 27291706)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26694500
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGATGTCCAAATGTGGAATTGTCATGCGTGATCCCATCACAGAGGAATA[T/A]AAAATCAAAATATACAAGGACAAAGACGGGAACCAAAAAGGAGATGGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13523
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079174 Essential Splice Site 312 450 8 10
Genomic Location (Zv9):
Chromosome 10 (position 27297027)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26699821
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACAGAATGTGAGAAATTCGGGCAAGTGAAGAAAGTGATCATTTTTGATG[T/A]AAGTCCTCTTYTACTCCTGCAACATATTGACCTTATTCTTCAYGWACRAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13135
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079174 Nonsense 364 450 10 10
Genomic Location (Zv9):
Chromosome 10 (position 27302285)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26705079
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTCTTCATTATCTCTGTKTGTTTGGTCACCCAGRTTGAGGAAACGTCA[C/T]GAGAGCGAGAAGAGAGACTGAAAGGCTGGTYGTCTTTTCTGGGCGAYGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link