htatsf1

Ensembl ID:
ENSDARG00000056649
ZFIN ID:
ZDB-GENE-040426-1578
Description:
HIV TAT specific factor 1 [Source:RefSeq peptide;Acc:NP_957497]
Human Orthologue:
HTATSF1
Human Description:
HIV-1 Tat specific factor 1 [Source:HGNC Symbol;Acc:5276]
Mouse Orthologue:
Htatsf1
Mouse Description:
HIV TAT specific factor 1 Gene [Source:MGI Symbol;Acc:MGI:1919709]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13523 Essential Splice Site Available for shipment Available now
sa13135 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13523
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079174 Essential Splice Site 312 450 8 10
Genomic Location:
Chromosome 10 (position 27297027)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACAGAATGTGAGAAATTCGGGCAAGTGAAGAAAGTGATCATTTTTGATG[T/A]AAGTCCTCTTYTACTCCTGCAACATATTGACCTTATTCTTCAYGWACRAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13135
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079174 Nonsense 364 450 10 10
Genomic Location:
Chromosome 10 (position 27302285)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTCTTCATTATCTCTGTKTGTTTGGTCACCCAGRTTGAGGAAACGTCA[C/T]GAGAGCGAGAAGAGAGACTGAAAGGCTGGTYGTCTTTTCTGGGCGAYGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ax1e7o90