klhl3

Ensembl ID:
ENSDARG00000056647
Human Orthologue:
KLHL3
Human Description:
kelch-like 3 (Drosophila) [Source:HGNC Symbol;Acc:6354]
Mouse Orthologue:
Klhl3
Mouse Description:
kelch-like 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2445185]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22473 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22473
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079164 Nonsense 541 601 13 15
Genomic Location (Zv9):
Chromosome 14 (position 25298119)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 24001210
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGATCCCACAACAAACACCTGGAGACAGGTGTGTGACATGAACATGTGT[C/T]GAAGGAATGCAGGTGAGTCATTAGAGGAAAGGAGGGGGACATATAGTTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link