hdac9b

Ensembl ID:
ENSDARG00000056642
ZFIN ID:
ZDB-GENE-040109-7
Description:
Histone deacetylase 9-B [Source:UniProtKB/Swiss-Prot;Acc:Q6PBI4]
Human Orthologue:
HDAC9
Human Description:
histone deacetylase 9 [Source:HGNC Symbol;Acc:14065]
Mouse Orthologue:
Hdac9
Mouse Description:
histone deacetylase 9 Gene [Source:MGI Symbol;Acc:MGI:1931221]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22811 Missense Available for shipment Available now

Mutation Details

Allele Name:
sa22811
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079155 Missense 243 643 6 13
ENSDART00000079159 Missense 212 612 4 11
ENSDART00000147161 Missense 209 267 4 6

The following transcripts of ENSDARG00000056642 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 21963948)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 20070391
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACATTGAATGGGATCCCTCAGAAAATCACGCAGAGCTCTAAACTCTGG[T/C]ACACGTAAGTTGTCTTCATGTGTACTGTTTAACTTACAGGATTAATTTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Male-pattern baldness: Six novel susceptibility Loci for early-onset androgenetic alopecia and their unexpected association with common diseases. (View Study)
  • Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
  • Retinopathy in non-diabetics: Genome-wide association study of retinopathy in individuals without diabetes. (View Study)
  • Stroke: Genome-wide association study identifies a variant in HDAC9 associated with large vessel ischemic stroke. (View Study)
  • Stroke (ischemic): Genetic risk factors for ischaemic stroke and its subtypes (the METASTROKE collaboration): a meta-analysis of genome-wide association studies. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link