pir

Ensembl ID:
ENSDARG00000056638
ZFIN ID:
ZDB-GENE-040718-288
Description:
pirin [Source:RefSeq peptide;Acc:NP_001002550]
Human Orthologue:
PIR
Human Description:
pirin (iron-binding nuclear protein) [Source:HGNC Symbol;Acc:30048]
Mouse Orthologue:
Pir
Mouse Description:
pirin Gene [Source:MGI Symbol;Acc:MGI:1916906]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41863 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41863
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079160 Essential Splice Site 185 289 5 9
ENSDART00000145251 Essential Splice Site 186 290 5 9

The following transcripts of ENSDARG00000056638 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 30800858)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29676844
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACTTTTTGCTGAAGAAAGATGCAAAACACATGCAGCCTGTTCCAAAAG[G/A]TAAAATGATTATTAAATATATTTGTTTTTCCCCACATTTTAGGGAAGAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link