fgf13l

Ensembl ID:
ENSDARG00000056633
ZFIN ID:
ZDB-GENE-040426-1793
Description:
fibroblast growth factor 13, like [Source:RefSeq peptide;Acc:NP_991265]
Human Orthologue:
FGF13
Human Description:
fibroblast growth factor 13 [Source:HGNC Symbol;Acc:3670]
Mouse Orthologue:
Fgf13
Mouse Description:
fibroblast growth factor 13 Gene [Source:MGI Symbol;Acc:MGI:109178]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34919 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34919
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020096 Nonsense 110 193 4 5
ENSDART00000145532 Nonsense 99 182 3 4

The following transcripts of ENSDARG00000056633 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 27358869)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26761663
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCGGTGTTTGAGAACTATTACGTGACCTACTCGTCAATGATCTACAGA[C/T]AACAGCAGTCGGGCCGAGGCTGGTACCTGGGTCTCAACAAAGAGGGTCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link