angptl5

Ensembl ID:
ENSDARG00000056630
ZFIN ID:
ZDB-GENE-030131-5054
Description:
Novel protein similar to angiopoietins [Source:UniProtKB/TrEMBL;Acc:Q6ZM91]
Human Orthologue:
ANGPTL5
Human Description:
angiopoietin-like 5 [Source:HGNC Symbol;Acc:19705]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25159 Nonsense Mutation detected in F1 DNA During 2014
sa23931 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa25159
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079161 Nonsense 177 399 5 8
Genomic Location:
Chromosome 21 (position 21939501)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGTGACATAAAAGAAACACTAGGTGCCGTTTCCCCAAAAATCCCAAGT[G/T]GAATTTACATAATTCAGCCAGAAAACACAGATGTTTCGTTTGAGGAAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23931
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079161 Nonsense 289 399 7 8
Genomic Location:
Chromosome 21 (position 21936674)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTGGATTGAAGACGAAACCAAATTCTTCGCAATTCACCTTGGCAGATA[C/A]GCTGGTAGTGCAGGTCAGCCAATTGCAAATACTACGCTGCTTTTTCCATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nnc0qgwv