trpc6

Ensembl ID:
ENSDARG00000056625
ZFIN IDs:
ZDB-GENE-040724-114, ZDB-GENE-040724-114
Description:
short transient receptor potential channel 6 [Source:RefSeq peptide;Acc:NP_001025453]
Human Orthologue:
TRPC6
Human Description:
transient receptor potential cation channel, subfamily C, member 6 [Source:HGNC Symbol;Acc:12338]
Mouse Orthologue:
Trpc6
Mouse Description:
transient receptor potential cation channel, subfamily C, member 6 Gene [Source:MGI Symbol;Acc:MGI:1

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23930 Nonsense Available for shipment Available now
sa37301 Essential Splice Site Mutation detected in F1 DNA During 2016
sa15581 Essential Splice Site Available for shipment Available now
sa10188 Essential Splice Site Available for shipment Available now
sa37300 Essential Splice Site Mutation detected in F1 DNA During 2016
sa37299 Nonsense Mutation detected in F1 DNA During 2016
sa23929 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa23930
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079151 Nonsense 213 855 2 11
ENSDART00000112175 Nonsense 213 874 2 12
Genomic Location (Zv9):
Chromosome 21 (position 21925673)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22774086
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCGCTTTTCTCATGACGTCACTCCAGTCATTCTAGCCTCTCACTGTCAC[G/T]AGTACGAGATCGTGCACATACTTTTGGGAAAGGGTGCGCGCATTGAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37301
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079151 Essential Splice Site 485 855 6 11
ENSDART00000112175 Essential Splice Site 485 874 6 12
Genomic Location (Zv9):
Chromosome 21 (position 21923359)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22771772
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCCTGATGCAACATTCATGTATTTGTTTTCATGTCAATCTCTCTCTCA[G/A]GGATGATTTGGGCAGAGTGCAAGGAGATCTGGTCCCAAGGACCAAGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15581
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079151 Essential Splice Site 561 855 7 11
ENSDART00000112175 Essential Splice Site 561 874 7 12
Genomic Location (Zv9):
Chromosome 21 (position 21923051)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22771464
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACACTCCAAATCAACAACAAAGCAAAATATTTTTTTTNATTTTTGTTCC[A/C]GCTCGGATTGACTGGCTTCCATCAGATCCTCAGTTAGTCTCAGAGGGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10188
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079151 Essential Splice Site 781 855 9 11
ENSDART00000112175 Essential Splice Site 781 874 9 12
Genomic Location (Zv9):
Chromosome 21 (position 21918881)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22767294
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTTTCTGTCAGGCAAAAAGCCATTATGAAGGGGTCTGAACTCAGTGAG[G/A]TGAGGCAAATCCAYTCTTTTRCATTAAGTTRTAGTGACATTARCMATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37300
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079151   None 855 None 11
ENSDART00000112175 Essential Splice Site 782 874 10 12
Genomic Location (Zv9):
Chromosome 21 (position 21916868)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22765281
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCATTCATATGTGTCCTGTGGTTTGTTGGGTCATTTGTTTACAATTCA[G/A]TTGGGACAGAGCAAAACTTGCCAGGCCAAGACTCTTCCACGTTCCAGTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37299
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079151 Nonsense 796 855 10 11
ENSDART00000112175 Nonsense 815 874 11 12
Genomic Location (Zv9):
Chromosome 21 (position 21916663)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22765076
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTACAGAAAATTATGAAGCGTCTTGTGAAGCGATACATCATCAAGGCT[C/T]AAAATGACAAGGAATGTGATGAAGTCAACGAGGGTGAGTGTCTGAATTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23929
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079151 Nonsense 799 855 10 11
ENSDART00000112175 Nonsense 818 874 11 12
Genomic Location (Zv9):
Chromosome 21 (position 21916654)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22765067
KASP Assay ID:
2261-5587.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATTATGAAGCGTCTTGTGAAGCGATACATCATCAAGGCTCAAAATGAC[A/T]AGGAATGTGATGAAGTCAACGAGGGTGAGTGTCTGAATTTGAGGAATAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link