ptenb

Ensembl ID:
ENSDARG00000056623
ZFIN ID:
ZDB-GENE-030616-47
Description:
phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase and dual-specificity protein phosphatase PTEN
Human Orthologue:
PTEN
Human Description:
phosphatase and tensin homolog [Source:HGNC Symbol;Acc:9588]
Mouse Orthologue:
Pten
Mouse Description:
phosphatase and tensin homolog Gene [Source:MGI Symbol;Acc:MGI:109583]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44756 Essential Splice Site Mutation detected in F1 DNA During 2017
hu1435 Nonsense Available for shipment Available now
sa17852 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44756
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079138 Essential Splice Site 55 422 2 10
ENSDART00000079144 Essential Splice Site 55 399 2 9
Genomic Location (Zv9):
Chromosome 12 (position 18487481)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGAAAGACTGGAGGGTGTATATAGAAACAACATAGATGATGTAGTGAG[G/A]TAAGTATTCACTTTGTTCTTGCTAGAGATTTTGTCAGGATAACCATTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu1435
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079138 Nonsense 65 422 3 10
ENSDART00000079144 Nonsense 65 399 3 9
Genomic Location (Zv9):
Chromosome 12 (position 18482481)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17293058
KASP Assay ID:
554-0393.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTCTATCTTGTTTTGCAGGTTTCTTGATTCAAAGCATAAAGATCATTA[C/A]AAGATATATAACCTGTAAGTGTGTTTCAAAAACTTCAGTTCTGTGATATC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa17852
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079138 Nonsense 284 422 8 10
ENSDART00000079144 Nonsense 261 399 7 9
Genomic Location (Zv9):
Chromosome 12 (position 18473094)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17283671
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCAACCACTGCCTGTGTGTGGGGACATCAAGGTGGAGTTCTTCCACAAA[C/T]AAAACAAGAWGATGAAGAAGGTATGAGTYCGTTCTAAACAGCCTAGTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link