ctcf

Ensembl ID:
ENSDARG00000056621
ZFIN ID:
ZDB-GENE-040624-5
Description:
transcriptional repressor CTCF [Source:RefSeq peptide;Acc:NP_001001844]
Human Orthologue:
CTCF
Human Description:
CCCTC-binding factor (zinc finger protein) [Source:HGNC Symbol;Acc:13723]
Mouse Orthologue:
Ctcf
Mouse Description:
CCCTC-binding factor Gene [Source:MGI Symbol;Acc:MGI:109447]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14093 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14093
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059913 None None 419 None 7
ENSDART00000079139 Nonsense 740 798 12 12
ENSDART00000124429 Nonsense 740 798 11 11
Genomic Location:
Chromosome 18 (position 22072193)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACAGCTGCTGCCATTATCCAGGTGGAGGATGAAAGCACAGGGGCCATT[G/T]AGAACATCATTGTGAAGAAGGAGCCAGAGGGCACTGACGCAGTTGTAGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Triglycerides: Loci influencing lipid levels and coronary heart disease risk in 16 European population cohorts. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9jn52u69