grpr

Ensembl ID:
ENSDARG00000056620
ZFIN ID:
ZDB-GENE-081015-4
Human Orthologue:
GRPR
Human Description:
gastrin-releasing peptide receptor [Source:HGNC Symbol;Acc:4609]
Mouse Orthologue:
Grpr
Mouse Description:
gastrin releasing peptide receptor Gene [Source:MGI Symbol;Acc:MGI:95836]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21937 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21937
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079150 Nonsense 100 376 1 3
Genomic Location (Zv9):
Chromosome 11 (position 30733282)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29609268
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGTCACCTGCGCGCCCGTGGATGCCAGCAAGTTCCTGGCGGATGAGTG[G/A]CTCTTCGGGCGGATGGGTTGCAAACTCATCCCGTTCATCCAGCTGACTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link