rpgra

Ensembl ID:
ENSDARG00000056617
ZFIN ID:
ZDB-GENE-070912-423
Description:
Retinitis pigmentosa GTPase regulator protein 1 [Source:UniProtKB/TrEMBL;Acc:D2X898]
Human Orthologue:
RPGR
Human Description:
retinitis pigmentosa GTPase regulator [Source:HGNC Symbol;Acc:10295]
Mouse Orthologue:
Rpgr
Mouse Description:
retinitis pigmentosa GTPase regulator Gene [Source:MGI Symbol;Acc:MGI:1344037]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14986 Nonsense Available for shipment Available now
sa41448 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa14986
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079095 Nonsense 749 1698 13 13
ENSDART00000131781   None 367 None 9
Genomic Location (Zv9):
Chromosome 9 (position 31318896)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30474842
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CKCAAAGCGACATTGAGCCTTCAATTGAAACACTGATCAACACACAGGAA[C/T]AGCGGAACTTAACACCAGTCAAAATTACAGCCGAAATGCAAAGCACCCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41448
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079095 Nonsense 913 1698 13 13
ENSDART00000131781   None 367 None 9
Genomic Location (Zv9):
Chromosome 9 (position 31319390)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30475336
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTATTAAAAGCTTAGCTCCAGAGAGAAGCCACTCAGTTTCCAATTTATG[G/A]TCCAATAACCAATCAGCAACCAATAAATCGTCCGCCCCAAAAGCAGCTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link