atad1b

Ensembl ID:
ENSDARG00000056609
ZFIN ID:
ZDB-GENE-030616-44
Description:
ATPase family AAA domain-containing protein 1-B [Source:UniProtKB/Swiss-Prot;Acc:Q503W7]
Human Orthologue:
ATAD1
Human Description:
ATPase family, AAA domain containing 1 [Source:HGNC Symbol;Acc:25903]
Mouse Orthologue:
Atad1
Mouse Description:
ATPase family, AAA domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1915229]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1271 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1271
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079130 Splice Site, Nonsense 58 362 2 10
ENSDART00000140927 Splice Site, Nonsense 58 281 2 8
Genomic Location:
Chromosome 12 (position 18507320)
KASP Assay ID:
554-1186.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTTGATGCTATCGATCCAACAAGAAAACAAAAGGTTGAGGCACAAAAA[C/T]AGGTAAGGTGTTTGATTTCAGCATCAGTTGTGTACATGAGTGTGCCTTTA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/uubm7ee2